Incidental Mutation 'R7826:Donson'
ID602213
Institutional Source Beutler Lab
Gene Symbol Donson
Ensembl Gene ENSMUSG00000022960
Gene Namedownstream neighbor of SON
SynonymsDonson, ORF60, 1110025J21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R7826 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location91676808-91688770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91688456 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 86 (D86G)
Ref Sequence ENSEMBL: ENSMUSP00000123648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023682] [ENSMUST00000073466] [ENSMUST00000114031] [ENSMUST00000117159] [ENSMUST00000117644] [ENSMUST00000122254] [ENSMUST00000124282] [ENSMUST00000133942] [ENSMUST00000136699] [ENSMUST00000138560] [ENSMUST00000139324] [ENSMUST00000144461] [ENSMUST00000159295] [ENSMUST00000145833]
Predicted Effect probably benign
Transcript: ENSMUST00000023682
AA Change: D86G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023682
Gene: ENSMUSG00000022960
AA Change: D86G

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073466
SMART Domains Protein: ENSMUSP00000073171
Gene: ENSMUSG00000058240

DomainStartEndE-ValueType
Pfam:ADH_N 30 142 3.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114031
AA Change: D86G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109665
Gene: ENSMUSG00000022960
AA Change: D86G

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117159
AA Change: D86G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113220
Gene: ENSMUSG00000022960
AA Change: D86G

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117644
SMART Domains Protein: ENSMUSP00000113227
Gene: ENSMUSG00000058240

DomainStartEndE-ValueType
Pfam:ADH_zinc_N 141 212 1.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122254
SMART Domains Protein: ENSMUSP00000112734
Gene: ENSMUSG00000058240

DomainStartEndE-ValueType
Blast:PKS_ER 71 150 1e-9 BLAST
SCOP:d1heta1 73 137 4e-12 SMART
low complexity region 172 190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124282
SMART Domains Protein: ENSMUSP00000115686
Gene: ENSMUSG00000058240

DomainStartEndE-ValueType
Pfam:ADH_N 30 150 1.7e-8 PFAM
Pfam:ADH_zinc_N 156 227 3.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133942
SMART Domains Protein: ENSMUSP00000121386
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 128 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136699
Predicted Effect probably benign
Transcript: ENSMUST00000138560
AA Change: D83G

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121591
Gene: ENSMUSG00000022960
AA Change: D83G

DomainStartEndE-ValueType
low complexity region 31 52 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139324
AA Change: D86G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120957
Gene: ENSMUSG00000022960
AA Change: D86G

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144461
AA Change: D86G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123648
Gene: ENSMUSG00000022960
AA Change: D86G

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144472
SMART Domains Protein: ENSMUSP00000116833
Gene: ENSMUSG00000058240

DomainStartEndE-ValueType
Blast:PKS_ER 2 152 8e-13 BLAST
PDB:3SLK|B 2 152 3e-10 PDB
SCOP:d1heta1 24 103 1e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159295
SMART Domains Protein: ENSMUSP00000125172
Gene: ENSMUSG00000116933

DomainStartEndE-ValueType
Pfam:OSCP 1 89 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145833
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene lies downstream of the SON gene and spans 10 kb on chromosome 21. The function of this gene is unknown. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout is early embryonic lethal. Heterozygous knockout causes no observable phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap27 T C 11: 103,338,327 T521A probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Btbd9 A T 17: 30,334,327 I387N probably benign Het
Ccdc27 C T 4: 154,039,501 probably null Het
Ccdc88a A T 11: 29,503,563 H1642L probably benign Het
Cd300c2 C T 11: 115,000,818 V77I possibly damaging Het
Chrnb2 A T 3: 89,763,243 S63T probably damaging Het
Dlgap2 C T 8: 14,743,410 P467L probably benign Het
Dnah5 C T 15: 28,367,812 T2781M probably damaging Het
Echs1 T A 7: 140,116,436 probably benign Het
Epha8 C T 4: 136,936,187 M483I probably benign Het
Eprs T G 1: 185,406,968 V850G probably damaging Het
Fbxw5 C A 2: 25,502,549 C114* probably null Het
Gm5160 C T 18: 14,425,072 R69C probably benign Het
Gm996 C A 2: 25,578,465 R478L possibly damaging Het
Gpr75 A G 11: 30,891,209 H38R probably damaging Het
Igsf9 T C 1: 172,491,630 V230A probably benign Het
Lonp2 C T 8: 86,709,013 P626S probably damaging Het
Lrrtm1 G T 6: 77,244,112 probably null Het
Man1a2 T C 3: 100,582,139 E508G probably damaging Het
Mipep C A 14: 60,802,131 A203E probably damaging Het
Mrc1 T A 2: 14,294,857 C753S probably damaging Het
Mthfr A G 4: 148,055,010 E568G probably benign Het
Naca T A 10: 128,043,610 probably benign Het
Nek10 G A 14: 14,860,846 probably null Het
Nf2 T C 11: 4,789,750 T419A probably benign Het
Npas3 A G 12: 53,831,756 T164A possibly damaging Het
Nudcd3 T A 11: 6,150,581 I124F possibly damaging Het
Olfr952 A G 9: 39,426,127 *315Q probably null Het
Pappa2 A T 1: 158,936,440 C500* probably null Het
Pcdhb18 T A 18: 37,490,942 S442T probably damaging Het
Phactr4 T C 4: 132,378,441 N105D possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Pzp T C 6: 128,487,533 T1344A probably benign Het
Ranbp9 T C 13: 43,419,621 I312V possibly damaging Het
Rsf1 A G 7: 97,661,161 probably benign Het
Slc6a4 A T 11: 77,013,025 I150L probably benign Het
Smpd5 T C 15: 76,296,296 S433P probably benign Het
Spats1 C T 17: 45,452,718 D209N probably damaging Het
Spcs2 C T 7: 99,839,777 G235R probably damaging Het
Sptlc3 T C 2: 139,547,195 M165T probably benign Het
Synm T C 7: 67,735,589 D775G probably damaging Het
Tango6 A G 8: 106,692,613 D264G probably benign Het
Tbc1d30 A T 10: 121,296,805 L218H probably damaging Het
Tmem132d A G 5: 127,789,889 I649T probably damaging Het
Tmem145 T C 7: 25,307,514 Y114H probably damaging Het
Triml1 A T 8: 43,138,766 V185E possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T G 2: 76,884,876 probably benign Het
Utrn C T 10: 12,401,306 probably null Het
Uty T C Y: 1,137,716 K887E possibly damaging Het
Zfand2b T C 1: 75,168,858 F3L possibly damaging Het
Zfp280d C A 9: 72,312,671 Q243K possibly damaging Het
Zfp418 T C 7: 7,182,669 F544L probably benign Het
Other mutations in Donson
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Donson APN 16 91682591 missense possibly damaging 0.79
IGL02458:Donson APN 16 91681176 missense probably damaging 0.97
IGL03238:Donson APN 16 91681246 nonsense probably null
IGL02802:Donson UTSW 16 91681308 missense possibly damaging 0.66
R0525:Donson UTSW 16 91686245 missense probably damaging 1.00
R0831:Donson UTSW 16 91683763 missense probably damaging 1.00
R3706:Donson UTSW 16 91686161 unclassified probably benign
R4191:Donson UTSW 16 91688592 missense possibly damaging 0.81
R4746:Donson UTSW 16 91682237 missense probably damaging 1.00
R4788:Donson UTSW 16 91687833 missense possibly damaging 0.66
R4947:Donson UTSW 16 91682551 missense probably damaging 1.00
R5171:Donson UTSW 16 91681293 missense possibly damaging 0.93
R5439:Donson UTSW 16 91679926 missense probably damaging 0.99
R5739:Donson UTSW 16 91681229 splice site probably null
R5809:Donson UTSW 16 91687850 missense possibly damaging 0.69
R6964:Donson UTSW 16 91681219 missense probably benign 0.11
R7022:Donson UTSW 16 91681330 missense probably damaging 1.00
R7110:Donson UTSW 16 91682121 nonsense probably null
R7326:Donson UTSW 16 91688711 start codon destroyed probably null 0.99
R8354:Donson UTSW 16 91683797 missense possibly damaging 0.95
Z1177:Donson UTSW 16 91688472 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCTTACAGGAGAGGGCAGC -3'
(R):5'- CTACTCGCCTAGCTTCAAGAG -3'

Sequencing Primer
(F):5'- CAGCTCAGGACATCAGC -3'
(R):5'- TTCAAGAGGCCGCCTGAGAC -3'
Posted On2019-12-03