Incidental Mutation 'R7826:Uty'
ID602219
Institutional Source Beutler Lab
Gene Symbol Uty
Ensembl Gene ENSMUSG00000068457
Gene Nameubiquitously transcribed tetratricopeptide repeat gene, Y chromosome
SynonymsHydb
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7826 (G1)
Quality Score221.999
Status Validated
ChromosomeY
Chromosomal Location1096861-1245759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 1137716 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 887 (K887E)
Ref Sequence ENSEMBL: ENSMUSP00000114752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069309] [ENSMUST00000139365] [ENSMUST00000143286] [ENSMUST00000154004] [ENSMUST00000154666]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069309
AA Change: K888E

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070012
Gene: ENSMUSG00000068457
AA Change: K888E

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
TPR 88 121 1.51e1 SMART
TPR 125 158 2.26e-3 SMART
TPR 200 233 2.31e0 SMART
TPR 279 312 6.19e-1 SMART
TPR 313 346 4.21e-3 SMART
TPR 347 380 8.97e0 SMART
Blast:JmjC 389 470 2e-28 BLAST
low complexity region 534 551 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 693 705 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
low complexity region 784 795 N/A INTRINSIC
JmjC 907 1070 5.22e-47 SMART
Blast:JmjC 1106 1170 1e-27 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000139365
AA Change: K887E

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114752
Gene: ENSMUSG00000068457
AA Change: K887E

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
TPR 87 120 1.51e1 SMART
TPR 124 157 2.26e-3 SMART
TPR 199 232 2.31e0 SMART
TPR 278 311 6.19e-1 SMART
TPR 312 345 4.21e-3 SMART
TPR 346 379 8.97e0 SMART
Blast:JmjC 388 469 2e-28 BLAST
low complexity region 533 550 N/A INTRINSIC
low complexity region 630 645 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 730 743 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
JmjC 906 1069 5.22e-47 SMART
Blast:JmjC 1105 1169 1e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143286
AA Change: K787E

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000115113
Gene: ENSMUSG00000068457
AA Change: K787E

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
TPR 69 102 2.26e-3 SMART
TPR 144 177 2.31e0 SMART
TPR 223 256 6.19e-1 SMART
TPR 257 290 4.21e-3 SMART
TPR 291 324 8.97e0 SMART
low complexity region 433 450 N/A INTRINSIC
low complexity region 530 545 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 683 694 N/A INTRINSIC
JmjC 806 969 5.22e-47 SMART
Blast:JmjC 1005 1069 1e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154004
AA Change: K825E

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114910
Gene: ENSMUSG00000068457
AA Change: K825E

DomainStartEndE-ValueType
TPR 25 58 1.51e1 SMART
TPR 62 95 2.26e-3 SMART
TPR 137 170 2.31e0 SMART
TPR 216 249 6.19e-1 SMART
TPR 250 283 4.21e-3 SMART
TPR 284 317 8.97e0 SMART
Blast:JmjC 326 407 2e-28 BLAST
low complexity region 471 488 N/A INTRINSIC
low complexity region 568 583 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 668 681 N/A INTRINSIC
low complexity region 721 732 N/A INTRINSIC
JmjC 844 1007 5.22e-47 SMART
Blast:JmjC 1043 1107 1e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154666
SMART Domains Protein: ENSMUSP00000122818
Gene: ENSMUSG00000068457

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mutant male mice hemizygous for a gene trapped allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap27 T C 11: 103,338,327 T521A probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Btbd9 A T 17: 30,334,327 I387N probably benign Het
Ccdc27 C T 4: 154,039,501 probably null Het
Ccdc88a A T 11: 29,503,563 H1642L probably benign Het
Cd300c2 C T 11: 115,000,818 V77I possibly damaging Het
Chrnb2 A T 3: 89,763,243 S63T probably damaging Het
Dlgap2 C T 8: 14,743,410 P467L probably benign Het
Dnah5 C T 15: 28,367,812 T2781M probably damaging Het
Donson T C 16: 91,688,456 D86G possibly damaging Het
Echs1 T A 7: 140,116,436 probably benign Het
Epha8 C T 4: 136,936,187 M483I probably benign Het
Eprs T G 1: 185,406,968 V850G probably damaging Het
Fbxw5 C A 2: 25,502,549 C114* probably null Het
Gm5160 C T 18: 14,425,072 R69C probably benign Het
Gm996 C A 2: 25,578,465 R478L possibly damaging Het
Gpr75 A G 11: 30,891,209 H38R probably damaging Het
Igsf9 T C 1: 172,491,630 V230A probably benign Het
Lonp2 C T 8: 86,709,013 P626S probably damaging Het
Lrrtm1 G T 6: 77,244,112 probably null Het
Man1a2 T C 3: 100,582,139 E508G probably damaging Het
Mipep C A 14: 60,802,131 A203E probably damaging Het
Mrc1 T A 2: 14,294,857 C753S probably damaging Het
Mthfr A G 4: 148,055,010 E568G probably benign Het
Naca T A 10: 128,043,610 probably benign Het
Nek10 G A 14: 14,860,846 probably null Het
Nf2 T C 11: 4,789,750 T419A probably benign Het
Npas3 A G 12: 53,831,756 T164A possibly damaging Het
Nudcd3 T A 11: 6,150,581 I124F possibly damaging Het
Olfr952 A G 9: 39,426,127 *315Q probably null Het
Pappa2 A T 1: 158,936,440 C500* probably null Het
Pcdhb18 T A 18: 37,490,942 S442T probably damaging Het
Phactr4 T C 4: 132,378,441 N105D possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Pzp T C 6: 128,487,533 T1344A probably benign Het
Ranbp9 T C 13: 43,419,621 I312V possibly damaging Het
Rsf1 A G 7: 97,661,161 probably benign Het
Slc6a4 A T 11: 77,013,025 I150L probably benign Het
Smpd5 T C 15: 76,296,296 S433P probably benign Het
Spats1 C T 17: 45,452,718 D209N probably damaging Het
Spcs2 C T 7: 99,839,777 G235R probably damaging Het
Sptlc3 T C 2: 139,547,195 M165T probably benign Het
Synm T C 7: 67,735,589 D775G probably damaging Het
Tango6 A G 8: 106,692,613 D264G probably benign Het
Tbc1d30 A T 10: 121,296,805 L218H probably damaging Het
Tmem132d A G 5: 127,789,889 I649T probably damaging Het
Tmem145 T C 7: 25,307,514 Y114H probably damaging Het
Triml1 A T 8: 43,138,766 V185E possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T G 2: 76,884,876 probably benign Het
Utrn C T 10: 12,401,306 probably null Het
Zfand2b T C 1: 75,168,858 F3L possibly damaging Het
Zfp280d C A 9: 72,312,671 Q243K possibly damaging Het
Zfp418 T C 7: 7,182,669 F544L probably benign Het
Other mutations in Uty
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0139:Uty UTSW Y 1197223 missense probably damaging 1.00
R0277:Uty UTSW Y 1169979 missense probably damaging 1.00
R0323:Uty UTSW Y 1169979 missense probably damaging 1.00
R1102:Uty UTSW Y 1174741 missense probably damaging 1.00
R1256:Uty UTSW Y 1134884 missense probably damaging 0.96
R1499:Uty UTSW Y 1197228 missense probably damaging 1.00
R1534:Uty UTSW Y 1245440 missense probably benign 0.41
R1643:Uty UTSW Y 1152054 missense probably damaging 1.00
R2070:Uty UTSW Y 1169193 missense probably benign 0.28
R2101:Uty UTSW Y 1176541 missense probably damaging 0.99
R2146:Uty UTSW Y 1239816 missense probably benign 0.25
R2508:Uty UTSW Y 1158182 missense probably damaging 1.00
R3036:Uty UTSW Y 1099671 nonsense probably null
R3437:Uty UTSW Y 1158336 missense probably benign 0.38
R3547:Uty UTSW Y 1158512 missense possibly damaging 0.78
R4153:Uty UTSW Y 1158327 missense possibly damaging 0.68
R4388:Uty UTSW Y 1151956 missense possibly damaging 0.94
R4467:Uty UTSW Y 1158372 missense possibly damaging 0.48
R4607:Uty UTSW Y 1131134 missense probably damaging 1.00
R4608:Uty UTSW Y 1131134 missense probably damaging 1.00
R4684:Uty UTSW Y 1176502 nonsense probably null
R4948:Uty UTSW Y 1136883 missense probably damaging 1.00
R5129:Uty UTSW Y 1158592 missense probably benign 0.13
R5387:Uty UTSW Y 1189339 missense probably damaging 1.00
R5408:Uty UTSW Y 1245614 missense possibly damaging 0.46
R5487:Uty UTSW Y 1174825 missense probably damaging 1.00
R5677:Uty UTSW Y 1134902 missense probably damaging 1.00
R5806:Uty UTSW Y 1170921 missense probably damaging 0.99
R6047:Uty UTSW Y 1158288 missense probably damaging 1.00
R6092:Uty UTSW Y 1174836 missense probably benign 0.08
R6759:Uty UTSW Y 1174735 missense probably damaging 0.98
R6761:Uty UTSW Y 1186790 missense probably damaging 1.00
R6949:Uty UTSW Y 1240000 splice site probably null
R7177:Uty UTSW Y 1099691 missense probably benign 0.33
R7251:Uty UTSW Y 1154262 missense probably benign
R7469:Uty UTSW Y 1131072 missense possibly damaging 0.71
R7582:Uty UTSW Y 1170914 missense probably damaging 1.00
R7686:Uty UTSW Y 1158075 missense possibly damaging 0.92
R7962:Uty UTSW Y 1154210 nonsense probably null
R8225:Uty UTSW Y 1158634 missense probably benign
R8354:Uty UTSW Y 1157928 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AATGTTGACAGCTTAACTCTTTGG -3'
(R):5'- TGATTTATGGTATTGCAGTAGGAAC -3'

Sequencing Primer
(F):5'- GTGGCACGCGACTTTAATC -3'
(R):5'- TGGTATTGCAGTAGGAACTTTAATAC -3'
Posted On2019-12-03