Incidental Mutation 'R7827:En2'
ID 602236
Institutional Source Beutler Lab
Gene Symbol En2
Ensembl Gene ENSMUSG00000039095
Gene Name engrailed 2
Synonyms En-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock # R7827 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 28165694-28172166 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 28166596 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 24 (G24S)
Ref Sequence ENSEMBL: ENSMUSP00000036761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036177]
AlphaFold P09066
Predicted Effect probably benign
Transcript: ENSMUST00000036177
AA Change: G24S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036761
Gene: ENSMUSG00000039095
AA Change: G24S

DomainStartEndE-ValueType
low complexity region 21 39 N/A INTRINSIC
low complexity region 81 112 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
HOX 235 297 1.72e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homeobox-containing genes are thought to have a role in controlling development. In Drosophila, the 'engrailed' (en) gene plays an important role during development in segmentation, where it is required for the formation of posterior compartments. Different mutations in the mouse homologs, En1 and En2, produced different developmental defects that frequently are lethal. The human engrailed homologs 1 and 2 encode homeodomain-containing proteins and have been implicated in the control of pattern formation during development of the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: This locus affects anterior-posterior cerebellar patterning. Homozygous null mutants show altered foliation pattern and perform poorly in motor learning (rotarod) tests. Heterozygotes test intermediate on rotarod. Hypomorphs show no phenotypic effects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,414,678 probably benign Het
Abcb1b T C 5: 8,837,747 S878P probably damaging Het
Adamts20 T C 15: 94,325,933 R1305G probably damaging Het
Adcy2 A T 13: 68,689,281 C650S probably damaging Het
Ahnak A T 19: 9,005,344 K1331* probably null Het
Alpk1 A T 3: 127,680,051 S768T probably benign Het
Ap4b1 T G 3: 103,815,082 L124R probably damaging Het
Arrdc2 A T 8: 70,839,394 F3Y probably damaging Het
Atp9a A G 2: 168,705,194 V155A probably benign Het
Bptf A G 11: 107,047,187 S87P probably benign Het
Carmil1 A T 13: 24,036,438 M697K probably benign Het
Ccdc42 G A 11: 68,594,196 V32M probably benign Het
Ces1d A G 8: 93,197,666 probably null Het
Col4a3bp A G 13: 96,617,055 H391R probably damaging Het
Dcpp2 T G 17: 23,900,592 Y127D probably damaging Het
Def8 C A 8: 123,447,321 T7K probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Evi2a T C 11: 79,527,862 probably benign Het
Fam117b A T 1: 59,913,678 H172L possibly damaging Het
Fam169b A G 7: 68,304,590 I67M probably benign Het
Fbxo40 T A 16: 36,969,499 E416D probably damaging Het
Gja8 T A 3: 96,920,319 N9I possibly damaging Het
Gm5538 A G 3: 59,743,691 N78S probably damaging Het
Gsg1l2 T A 11: 67,785,271 C154S probably benign Het
Hdhd3 C A 4: 62,499,995 probably benign Het
Hunk C T 16: 90,481,326 P341L possibly damaging Het
Ighv8-5 T C 12: 115,067,638 T94A possibly damaging Het
Ints3 T C 3: 90,424,012 N75D probably benign Het
Krt39 T C 11: 99,519,075 E212G probably damaging Het
Ldlrad4 A G 18: 68,254,424 H269R probably damaging Het
Lrrc2 T A 9: 110,960,981 V102E possibly damaging Het
Ltbp2 T A 12: 84,789,881 I1292L probably benign Het
Mad2l1bp A T 17: 46,148,067 V179E possibly damaging Het
Map3k1 A G 13: 111,756,129 V864A probably benign Het
Mapk8ip2 T G 15: 89,458,119 V511G probably damaging Het
Mknk2 A C 10: 80,667,187 S434A probably benign Het
Mllt11 A G 3: 95,220,237 F74S probably damaging Het
Muc16 G T 9: 18,595,223 T6412K possibly damaging Het
Nek5 C A 8: 22,083,387 A518S possibly damaging Het
Npy1r T C 8: 66,704,212 F95L possibly damaging Het
Nup98 G A 7: 102,124,362 T1586I probably benign Het
Olfr128 T A 17: 37,923,677 L37* probably null Het
Olfr1477 T G 19: 13,503,223 N293K probably damaging Het
Olfr303 T A 7: 86,394,557 K314* probably null Het
Olfr702 A G 7: 106,823,725 M267T probably benign Het
Olig3 A T 10: 19,356,770 M48L probably benign Het
Pcdhb16 A G 18: 37,478,851 D288G possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Phip T C 9: 82,908,833 I687V probably benign Het
Piezo1 G A 8: 122,482,920 T2348M probably damaging Het
Plod3 A G 5: 136,989,981 T291A probably benign Het
Pmpca G A 2: 26,390,132 V89I possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Pou6f2 C A 13: 18,378,507 A81S Het
Ppl T A 16: 5,087,964 E1489V probably damaging Het
Ptpdc1 A G 13: 48,579,788 F792S probably damaging Het
Pus1 A G 5: 110,779,716 Y58H probably damaging Het
Rex2 C A 4: 147,058,090 T345N possibly damaging Het
Rnf144a T C 12: 26,339,440 M1V probably null Het
Siglec15 A T 18: 78,057,230 C13* probably null Het
Skint10 G A 4: 112,774,806 Q6* probably null Het
Slc5a1 T C 5: 33,146,713 W291R probably damaging Het
Snx27 A G 3: 94,519,059 F378L probably benign Het
Strip2 A T 6: 29,923,929 T81S probably benign Het
Tas2r143 A G 6: 42,400,722 N162S probably damaging Het
Tatdn1 T C 15: 58,904,758 D256G probably benign Het
Tbc1d5 A G 17: 50,782,263 S630P probably damaging Het
Tlr11 A G 14: 50,361,154 D199G probably benign Het
Tmed8 C A 12: 87,200,217 probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 TAA TAAAGCAA 6: 113,399,162 probably null Het
U2af2 T C 7: 5,074,662 probably null Het
Ywhag C T 5: 135,911,540 E67K probably damaging Het
Zfp105 A G 9: 122,930,743 H493R probably damaging Het
Zfp426 A T 9: 20,470,150 C514S probably damaging Het
Zfp536 T A 7: 37,569,688 D101V probably damaging Het
Other mutations in En2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02943:En2 APN 5 28166526 utr 5 prime probably benign
R0928:En2 UTSW 5 28170331 nonsense probably null
R2083:En2 UTSW 5 28167073 missense probably damaging 0.98
R2356:En2 UTSW 5 28166332 start gained probably benign
R2762:En2 UTSW 5 28170421 missense probably damaging 0.99
R5470:En2 UTSW 5 28166924 missense probably benign 0.03
R5760:En2 UTSW 5 28166999 missense probably benign 0.41
R6762:En2 UTSW 5 28170353 missense possibly damaging 0.65
R7640:En2 UTSW 5 28170166 nonsense probably null
R7687:En2 UTSW 5 28170289 missense probably damaging 1.00
R8409:En2 UTSW 5 28166884 missense probably benign
R8861:En2 UTSW 5 28166735 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGACTGGTGATTTGCTAACGC -3'
(R):5'- AGCGTCTTGGAACCTCCTTC -3'

Sequencing Primer
(F):5'- ATCCGAACGTGGCTTGG -3'
(R):5'- TCCTTCGGTAGTGCCAGC -3'
Posted On 2019-12-03