Incidental Mutation 'R7827:Ttll3'
ID 602244
Institutional Source Beutler Lab
Gene Symbol Ttll3
Ensembl Gene ENSMUSG00000030276
Gene Name tubulin tyrosine ligase-like family, member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7827 (G1)
Quality Score 217.468
Status Not validated
Chromosome 6
Chromosomal Location 113389260-113414587 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) CAAAGTAA to CAAAGTAAAGTAA at 113399157 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032414] [ENSMUST00000038889] [ENSMUST00000204026] [ENSMUST00000205017]
AlphaFold A4Q9E5
Predicted Effect probably benign
Transcript: ENSMUST00000032414
SMART Domains Protein: ENSMUSP00000032414
Gene: ENSMUSG00000030276

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 698 7.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038889
SMART Domains Protein: ENSMUSP00000037870
Gene: ENSMUSG00000030276

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 699 9e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203524
Predicted Effect probably null
Transcript: ENSMUST00000204026
SMART Domains Protein: ENSMUSP00000145049
Gene: ENSMUSG00000030276

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205017
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduced number of primary cilia in colon epithelia accompanied by an increased rate of cell division which is compensated by faster tissue turnover in the colon. Mice exhibit increased incidence of colon tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,414,678 probably benign Het
Abcb1b T C 5: 8,837,747 S878P probably damaging Het
Adamts20 T C 15: 94,325,933 R1305G probably damaging Het
Adcy2 A T 13: 68,689,281 C650S probably damaging Het
Ahnak A T 19: 9,005,344 K1331* probably null Het
Alpk1 A T 3: 127,680,051 S768T probably benign Het
Ap4b1 T G 3: 103,815,082 L124R probably damaging Het
Arrdc2 A T 8: 70,839,394 F3Y probably damaging Het
Atp9a A G 2: 168,705,194 V155A probably benign Het
Bptf A G 11: 107,047,187 S87P probably benign Het
Carmil1 A T 13: 24,036,438 M697K probably benign Het
Ccdc42 G A 11: 68,594,196 V32M probably benign Het
Ces1d A G 8: 93,197,666 probably null Het
Col4a3bp A G 13: 96,617,055 H391R probably damaging Het
Dcpp2 T G 17: 23,900,592 Y127D probably damaging Het
Def8 C A 8: 123,447,321 T7K probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
En2 G A 5: 28,166,596 G24S probably benign Het
Evi2a T C 11: 79,527,862 probably benign Het
Fam117b A T 1: 59,913,678 H172L possibly damaging Het
Fam169b A G 7: 68,304,590 I67M probably benign Het
Fbxo40 T A 16: 36,969,499 E416D probably damaging Het
Gja8 T A 3: 96,920,319 N9I possibly damaging Het
Gm5538 A G 3: 59,743,691 N78S probably damaging Het
Gsg1l2 T A 11: 67,785,271 C154S probably benign Het
Hdhd3 C A 4: 62,499,995 probably benign Het
Hunk C T 16: 90,481,326 P341L possibly damaging Het
Ighv8-5 T C 12: 115,067,638 T94A possibly damaging Het
Ints3 T C 3: 90,424,012 N75D probably benign Het
Krt39 T C 11: 99,519,075 E212G probably damaging Het
Ldlrad4 A G 18: 68,254,424 H269R probably damaging Het
Lrrc2 T A 9: 110,960,981 V102E possibly damaging Het
Ltbp2 T A 12: 84,789,881 I1292L probably benign Het
Mad2l1bp A T 17: 46,148,067 V179E possibly damaging Het
Map3k1 A G 13: 111,756,129 V864A probably benign Het
Mapk8ip2 T G 15: 89,458,119 V511G probably damaging Het
Mknk2 A C 10: 80,667,187 S434A probably benign Het
Mllt11 A G 3: 95,220,237 F74S probably damaging Het
Muc16 G T 9: 18,595,223 T6412K possibly damaging Het
Nek5 C A 8: 22,083,387 A518S possibly damaging Het
Npy1r T C 8: 66,704,212 F95L possibly damaging Het
Nup98 G A 7: 102,124,362 T1586I probably benign Het
Olfr128 T A 17: 37,923,677 L37* probably null Het
Olfr1477 T G 19: 13,503,223 N293K probably damaging Het
Olfr303 T A 7: 86,394,557 K314* probably null Het
Olfr702 A G 7: 106,823,725 M267T probably benign Het
Olig3 A T 10: 19,356,770 M48L probably benign Het
Pcdhb16 A G 18: 37,478,851 D288G possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Phip T C 9: 82,908,833 I687V probably benign Het
Piezo1 G A 8: 122,482,920 T2348M probably damaging Het
Plod3 A G 5: 136,989,981 T291A probably benign Het
Pmpca G A 2: 26,390,132 V89I possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Pou6f2 C A 13: 18,378,507 A81S Het
Ppl T A 16: 5,087,964 E1489V probably damaging Het
Ptpdc1 A G 13: 48,579,788 F792S probably damaging Het
Pus1 A G 5: 110,779,716 Y58H probably damaging Het
Rex2 C A 4: 147,058,090 T345N possibly damaging Het
Rnf144a T C 12: 26,339,440 M1V probably null Het
Siglec15 A T 18: 78,057,230 C13* probably null Het
Skint10 G A 4: 112,774,806 Q6* probably null Het
Slc5a1 T C 5: 33,146,713 W291R probably damaging Het
Snx27 A G 3: 94,519,059 F378L probably benign Het
Strip2 A T 6: 29,923,929 T81S probably benign Het
Tas2r143 A G 6: 42,400,722 N162S probably damaging Het
Tatdn1 T C 15: 58,904,758 D256G probably benign Het
Tbc1d5 A G 17: 50,782,263 S630P probably damaging Het
Tlr11 A G 14: 50,361,154 D199G probably benign Het
Tmed8 C A 12: 87,200,217 probably benign Het
U2af2 T C 7: 5,074,662 probably null Het
Ywhag C T 5: 135,911,540 E67K probably damaging Het
Zfp105 A G 9: 122,930,743 H493R probably damaging Het
Zfp426 A T 9: 20,470,150 C514S probably damaging Het
Zfp536 T A 7: 37,569,688 D101V probably damaging Het
Other mutations in Ttll3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Ttll3 APN 6 113394729 missense probably damaging 1.00
IGL01677:Ttll3 APN 6 113412984 missense probably benign
IGL01697:Ttll3 APN 6 113399729 missense probably benign 0.00
IGL01944:Ttll3 APN 6 113414115 missense probably benign
IGL02688:Ttll3 APN 6 113399739 missense probably benign 0.00
IGL03068:Ttll3 APN 6 113409197 missense probably damaging 1.00
R0373:Ttll3 UTSW 6 113398777 missense probably damaging 1.00
R0472:Ttll3 UTSW 6 113409339 missense probably damaging 1.00
R0625:Ttll3 UTSW 6 113408903 critical splice acceptor site probably null
R1868:Ttll3 UTSW 6 113392764 missense possibly damaging 0.95
R2026:Ttll3 UTSW 6 113398770 missense probably damaging 1.00
R2061:Ttll3 UTSW 6 113409042 missense possibly damaging 0.76
R2128:Ttll3 UTSW 6 113412934 missense probably benign 0.31
R2896:Ttll3 UTSW 6 113392722 missense probably benign 0.15
R2903:Ttll3 UTSW 6 113407323 missense probably damaging 0.99
R2906:Ttll3 UTSW 6 113392510 unclassified probably benign
R4659:Ttll3 UTSW 6 113414141 missense probably benign
R4746:Ttll3 UTSW 6 113407392 missense probably damaging 1.00
R4984:Ttll3 UTSW 6 113412940 missense probably benign 0.00
R5358:Ttll3 UTSW 6 113401331 missense probably benign 0.26
R5372:Ttll3 UTSW 6 113401421 nonsense probably null
R5525:Ttll3 UTSW 6 113412978 missense probably benign
R5548:Ttll3 UTSW 6 113393117 missense probably damaging 1.00
R5694:Ttll3 UTSW 6 113399708 missense probably damaging 1.00
R5993:Ttll3 UTSW 6 113398031 nonsense probably null
R6119:Ttll3 UTSW 6 113394741 missense probably damaging 1.00
R6268:Ttll3 UTSW 6 113392563 missense probably benign 0.00
R6719:Ttll3 UTSW 6 113399032 intron probably benign
R6852:Ttll3 UTSW 6 113399155 frame shift probably null
R6852:Ttll3 UTSW 6 113399157 frame shift probably null
R6852:Ttll3 UTSW 6 113399159 frame shift probably null
R6853:Ttll3 UTSW 6 113399157 frame shift probably null
R6854:Ttll3 UTSW 6 113399157 frame shift probably null
R7170:Ttll3 UTSW 6 113413878 missense probably benign 0.41
R7239:Ttll3 UTSW 6 113399157 frame shift probably null
R7302:Ttll3 UTSW 6 113409285 missense probably damaging 1.00
R7330:Ttll3 UTSW 6 113399157 frame shift probably null
R7330:Ttll3 UTSW 6 113399164 frame shift probably null
R7586:Ttll3 UTSW 6 113399157 frame shift probably null
R7587:Ttll3 UTSW 6 113399157 frame shift probably null
R7701:Ttll3 UTSW 6 113399157 frame shift probably null
R7702:Ttll3 UTSW 6 113399157 frame shift probably null
R7776:Ttll3 UTSW 6 113399159 frame shift probably null
R7793:Ttll3 UTSW 6 113399159 frame shift probably null
R7797:Ttll3 UTSW 6 113394777 missense possibly damaging 0.76
R7824:Ttll3 UTSW 6 113399157 frame shift probably null
R7825:Ttll3 UTSW 6 113399157 frame shift probably null
R7825:Ttll3 UTSW 6 113399159 frame shift probably null
R7826:Ttll3 UTSW 6 113399157 frame shift probably null
R7827:Ttll3 UTSW 6 113399162 frame shift probably null
R7831:Ttll3 UTSW 6 113399157 frame shift probably null
R7832:Ttll3 UTSW 6 113399157 frame shift probably null
R7833:Ttll3 UTSW 6 113409337 missense probably damaging 1.00
R7966:Ttll3 UTSW 6 113399157 frame shift probably null
R8344:Ttll3 UTSW 6 113394998 missense probably damaging 1.00
R8418:Ttll3 UTSW 6 113394773 missense probably benign 0.04
R8768:Ttll3 UTSW 6 113408988 missense probably damaging 1.00
R9017:Ttll3 UTSW 6 113412889 missense probably benign 0.00
R9036:Ttll3 UTSW 6 113399696 missense possibly damaging 0.47
R9090:Ttll3 UTSW 6 113392635 missense probably benign
R9271:Ttll3 UTSW 6 113392635 missense probably benign
R9329:Ttll3 UTSW 6 113392674 missense probably benign
R9532:Ttll3 UTSW 6 113409009 missense possibly damaging 0.69
R9535:Ttll3 UTSW 6 113412873 missense probably damaging 1.00
R9725:Ttll3 UTSW 6 113409153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGAGCAAGCCTCCCCTTG -3'
(R):5'- TGGCCTGGACCAGTTTCATTTC -3'

Sequencing Primer
(F):5'- TGTGGCCTCTGTAACCCCAG -3'
(R):5'- GCTGCCTTGGAACTCACTATGAAG -3'
Posted On 2019-12-03