Incidental Mutation 'R7827:Olfr303'
ID602249
Institutional Source Beutler Lab
Gene Symbol Olfr303
Ensembl Gene ENSMUSG00000039608
Gene Nameolfactory receptor 303
SynonymsGA_x6K02T2NHDJ-9712819-9713778, MOR104-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R7827 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86391810-86397789 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 86394557 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 314 (K314*)
Ref Sequence ENSEMBL: ENSMUSP00000149419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053958] [ENSMUST00000215234] [ENSMUST00000215532] [ENSMUST00000215733] [ENSMUST00000216409]
Predicted Effect probably null
Transcript: ENSMUST00000053958
AA Change: K314*
SMART Domains Protein: ENSMUSP00000062459
Gene: ENSMUSG00000039608
AA Change: K314*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-52 PFAM
Pfam:7tm_1 41 307 4.9e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215234
AA Change: K314*
Predicted Effect probably null
Transcript: ENSMUST00000215532
AA Change: K314*
Predicted Effect probably null
Transcript: ENSMUST00000215733
AA Change: K314*
Predicted Effect probably null
Transcript: ENSMUST00000216409
AA Change: K314*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,414,678 probably benign Het
Abcb1b T C 5: 8,837,747 S878P probably damaging Het
Adamts20 T C 15: 94,325,933 R1305G probably damaging Het
Adcy2 A T 13: 68,689,281 C650S probably damaging Het
Ahnak A T 19: 9,005,344 K1331* probably null Het
Alpk1 A T 3: 127,680,051 S768T probably benign Het
Ap4b1 T G 3: 103,815,082 L124R probably damaging Het
Arrdc2 A T 8: 70,839,394 F3Y probably damaging Het
Atp9a A G 2: 168,705,194 V155A probably benign Het
Bptf A G 11: 107,047,187 S87P probably benign Het
Carmil1 A T 13: 24,036,438 M697K probably benign Het
Ccdc42 G A 11: 68,594,196 V32M probably benign Het
Ces1d A G 8: 93,197,666 probably null Het
Col4a3bp A G 13: 96,617,055 H391R probably damaging Het
Dcpp2 T G 17: 23,900,592 Y127D probably damaging Het
Def8 C A 8: 123,447,321 T7K probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
En2 G A 5: 28,166,596 G24S probably benign Het
Evi2a T C 11: 79,527,862 probably benign Het
Fam117b A T 1: 59,913,678 H172L possibly damaging Het
Fam169b A G 7: 68,304,590 I67M probably benign Het
Fbxo40 T A 16: 36,969,499 E416D probably damaging Het
Gja8 T A 3: 96,920,319 N9I possibly damaging Het
Gm5538 A G 3: 59,743,691 N78S probably damaging Het
Gsg1l2 T A 11: 67,785,271 C154S probably benign Het
Hdhd3 C A 4: 62,499,995 probably benign Het
Hunk C T 16: 90,481,326 P341L possibly damaging Het
Ighv8-5 T C 12: 115,067,638 T94A possibly damaging Het
Ints3 T C 3: 90,424,012 N75D probably benign Het
Krt39 T C 11: 99,519,075 E212G probably damaging Het
Ldlrad4 A G 18: 68,254,424 H269R probably damaging Het
Lrrc2 T A 9: 110,960,981 V102E possibly damaging Het
Ltbp2 T A 12: 84,789,881 I1292L probably benign Het
Mad2l1bp A T 17: 46,148,067 V179E possibly damaging Het
Map3k1 A G 13: 111,756,129 V864A probably benign Het
Mapk8ip2 T G 15: 89,458,119 V511G probably damaging Het
Mknk2 A C 10: 80,667,187 S434A probably benign Het
Mllt11 A G 3: 95,220,237 F74S probably damaging Het
Muc16 G T 9: 18,595,223 T6412K possibly damaging Het
Nek5 C A 8: 22,083,387 A518S possibly damaging Het
Npy1r T C 8: 66,704,212 F95L possibly damaging Het
Nup98 G A 7: 102,124,362 T1586I probably benign Het
Olfr128 T A 17: 37,923,677 L37* probably null Het
Olfr1477 T G 19: 13,503,223 N293K probably damaging Het
Olfr702 A G 7: 106,823,725 M267T probably benign Het
Olig3 A T 10: 19,356,770 M48L probably benign Het
Pcdhb16 A G 18: 37,478,851 D288G possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Phip T C 9: 82,908,833 I687V probably benign Het
Piezo1 G A 8: 122,482,920 T2348M probably damaging Het
Plod3 A G 5: 136,989,981 T291A probably benign Het
Pmpca G A 2: 26,390,132 V89I possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Pou6f2 C A 13: 18,378,507 A81S Het
Ppl T A 16: 5,087,964 E1489V probably damaging Het
Ptpdc1 A G 13: 48,579,788 F792S probably damaging Het
Pus1 A G 5: 110,779,716 Y58H probably damaging Het
Rex2 C A 4: 147,058,090 T345N possibly damaging Het
Rnf144a T C 12: 26,339,440 M1V probably null Het
Siglec15 A T 18: 78,057,230 C13* probably null Het
Skint10 G A 4: 112,774,806 Q6* probably null Het
Slc5a1 T C 5: 33,146,713 W291R probably damaging Het
Snx27 A G 3: 94,519,059 F378L probably benign Het
Strip2 A T 6: 29,923,929 T81S probably benign Het
Tas2r143 A G 6: 42,400,722 N162S probably damaging Het
Tatdn1 T C 15: 58,904,758 D256G probably benign Het
Tbc1d5 A G 17: 50,782,263 S630P probably damaging Het
Tlr11 A G 14: 50,361,154 D199G probably benign Het
Tmed8 C A 12: 87,200,217 probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 TAA TAAAGCAA 6: 113,399,162 probably null Het
U2af2 T C 7: 5,074,662 probably null Het
Ywhag C T 5: 135,911,540 E67K probably damaging Het
Zfp105 A G 9: 122,930,743 H493R probably damaging Het
Zfp426 A T 9: 20,470,150 C514S probably damaging Het
Zfp536 T A 7: 37,569,688 D101V probably damaging Het
Other mutations in Olfr303
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02228:Olfr303 APN 7 86395078 missense possibly damaging 0.50
IGL02902:Olfr303 APN 7 86394535 utr 3 prime probably benign
IGL02937:Olfr303 APN 7 86394590 missense possibly damaging 0.89
BB001:Olfr303 UTSW 7 86394730 missense probably damaging 1.00
BB011:Olfr303 UTSW 7 86394730 missense probably damaging 1.00
R1455:Olfr303 UTSW 7 86394595 missense probably damaging 0.97
R1524:Olfr303 UTSW 7 86394812 missense probably benign 0.01
R1762:Olfr303 UTSW 7 86395145 missense probably damaging 0.97
R3014:Olfr303 UTSW 7 86394676 missense probably benign 0.19
R3027:Olfr303 UTSW 7 86394553 missense probably benign 0.00
R4073:Olfr303 UTSW 7 86394947 missense probably damaging 0.98
R4502:Olfr303 UTSW 7 86395277 missense possibly damaging 0.49
R4503:Olfr303 UTSW 7 86395277 missense possibly damaging 0.49
R4607:Olfr303 UTSW 7 86394510 splice site probably null
R4608:Olfr303 UTSW 7 86394510 splice site probably null
R7134:Olfr303 UTSW 7 86395544 start gained probably benign
R7298:Olfr303 UTSW 7 86394923 missense probably damaging 1.00
R7924:Olfr303 UTSW 7 86394730 missense probably damaging 1.00
R8160:Olfr303 UTSW 7 86395265 missense possibly damaging 0.61
R8294:Olfr303 UTSW 7 86395279 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAGCCTGCTTGTAAGAG -3'
(R):5'- AAAACATTCTCAACTTGTGCCTCC -3'

Sequencing Primer
(F):5'- AGCCTGCTTGTAAGAGTCTAATG -3'
(R):5'- ATGGCACCATAATCTTTGCCTATG -3'
Posted On2019-12-03