Incidental Mutation 'R7827:Mknk2'
ID 602264
Institutional Source Beutler Lab
Gene Symbol Mknk2
Ensembl Gene ENSMUSG00000020190
Gene Name MAP kinase-interacting serine/threonine kinase 2
Synonyms Mnk2, 2010016G11Rik
MMRRC Submission 045881-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7827 (G1)
Quality Score 190.009
Status Not validated
Chromosome 10
Chromosomal Location 80501152-80512264 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 80503021 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 434 (S434A)
Ref Sequence ENSEMBL: ENSMUSP00000143508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003433] [ENSMUST00000197276] [ENSMUST00000198819] [ENSMUST00000199949] [ENSMUST00000200082]
AlphaFold Q8CDB0
Predicted Effect probably benign
Transcript: ENSMUST00000003433
AA Change: S387A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000003433
Gene: ENSMUSG00000020190
AA Change: S387A

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
S_TKc 36 321 7.09e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197276
SMART Domains Protein: ENSMUSP00000143679
Gene: ENSMUSG00000020190

DomainStartEndE-ValueType
SCOP:d1koba_ 52 118 3e-11 SMART
PDB:2AC3|A 59 118 3e-32 PDB
Blast:S_TKc 71 118 1e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198819
Predicted Effect probably benign
Transcript: ENSMUST00000199949
Predicted Effect probably benign
Transcript: ENSMUST00000200082
AA Change: S434A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143508
Gene: ENSMUSG00000020190
AA Change: S434A

DomainStartEndE-ValueType
low complexity region 60 70 N/A INTRINSIC
S_TKc 83 368 7.09e-88 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a serine/threonine-protein kinase, which is targeted by both the extracellular signal-regulated kinase and p38 mitogen-activated protein kinase pathways. This enzyme targets several substrates including eukaryotic translation initiation factor 4E and mammalian target of rapamycin, which are negatively regulated by its phosphorylation. Null mutant mice do not exhibit developmental or reproductive defects. However, mice null for both this protein and mitogen-activated protein kinase-interacting serine/threonine protein kinase 1 have delayed tumor development in phosphatase and tensin homolog mutant mice, indicating an oncogenic function for this gene in tumor development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous null mice are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm2 A G 3: 59,651,112 (GRCm39) N78S probably damaging Het
Abca12 G A 1: 71,453,837 (GRCm39) probably benign Het
Abcb1b T C 5: 8,887,747 (GRCm39) S878P probably damaging Het
Adamts20 T C 15: 94,223,814 (GRCm39) R1305G probably damaging Het
Adcy2 A T 13: 68,837,400 (GRCm39) C650S probably damaging Het
Ahnak A T 19: 8,982,708 (GRCm39) K1331* probably null Het
Alpk1 A T 3: 127,473,700 (GRCm39) S768T probably benign Het
Ap4b1 T G 3: 103,722,398 (GRCm39) L124R probably damaging Het
Arrdc2 A T 8: 71,292,038 (GRCm39) F3Y probably damaging Het
Atp9a A G 2: 168,547,114 (GRCm39) V155A probably benign Het
Bptf A G 11: 106,938,013 (GRCm39) S87P probably benign Het
Carmil1 A T 13: 24,220,421 (GRCm39) M697K probably benign Het
Ccdc42 G A 11: 68,485,022 (GRCm39) V32M probably benign Het
Cert1 A G 13: 96,753,563 (GRCm39) H391R probably damaging Het
Ces1d A G 8: 93,924,294 (GRCm39) probably null Het
Dcpp2 T G 17: 24,119,566 (GRCm39) Y127D probably damaging Het
Def8 C A 8: 124,174,060 (GRCm39) T7K probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,979,841 (GRCm39) probably null Het
En2 G A 5: 28,371,594 (GRCm39) G24S probably benign Het
Evi2a T C 11: 79,418,688 (GRCm39) probably benign Het
Fam117b A T 1: 59,952,837 (GRCm39) H172L possibly damaging Het
Fam169b A G 7: 67,954,338 (GRCm39) I67M probably benign Het
Fbxo40 T A 16: 36,789,861 (GRCm39) E416D probably damaging Het
Gja8 T A 3: 96,827,635 (GRCm39) N9I possibly damaging Het
Gsg1l2 T A 11: 67,676,097 (GRCm39) C154S probably benign Het
Hdhd3 C A 4: 62,418,232 (GRCm39) probably benign Het
Hunk C T 16: 90,278,214 (GRCm39) P341L possibly damaging Het
Ighv8-5 T C 12: 115,031,258 (GRCm39) T94A possibly damaging Het
Ints3 T C 3: 90,331,319 (GRCm39) N75D probably benign Het
Krt39 T C 11: 99,409,901 (GRCm39) E212G probably damaging Het
Ldlrad4 A G 18: 68,387,495 (GRCm39) H269R probably damaging Het
Lrrc2 T A 9: 110,790,049 (GRCm39) V102E possibly damaging Het
Ltbp2 T A 12: 84,836,655 (GRCm39) I1292L probably benign Het
Mad2l1bp A T 17: 46,458,993 (GRCm39) V179E possibly damaging Het
Map3k1 A G 13: 111,892,663 (GRCm39) V864A probably benign Het
Mapk8ip2 T G 15: 89,342,322 (GRCm39) V511G probably damaging Het
Mllt11 A G 3: 95,127,548 (GRCm39) F74S probably damaging Het
Muc16 G T 9: 18,506,519 (GRCm39) T6412K possibly damaging Het
Nek5 C A 8: 22,573,403 (GRCm39) A518S possibly damaging Het
Npy1r T C 8: 67,156,864 (GRCm39) F95L possibly damaging Het
Nup98 G A 7: 101,773,569 (GRCm39) T1586I probably benign Het
Olig3 A T 10: 19,232,518 (GRCm39) M48L probably benign Het
Or13n4 A G 7: 106,422,932 (GRCm39) M267T probably benign Het
Or14j7 T A 17: 38,234,568 (GRCm39) L37* probably null Het
Or5b120 T G 19: 13,480,587 (GRCm39) N293K probably damaging Het
Or6aa1 T A 7: 86,043,765 (GRCm39) K314* probably null Het
Pcdhb16 A G 18: 37,611,904 (GRCm39) D288G possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Phip T C 9: 82,790,886 (GRCm39) I687V probably benign Het
Piezo1 G A 8: 123,209,659 (GRCm39) T2348M probably damaging Het
Plod3 A G 5: 137,018,835 (GRCm39) T291A probably benign Het
Pmpca G A 2: 26,280,144 (GRCm39) V89I possibly damaging Het
Polr1b C A 2: 128,967,464 (GRCm39) F952L probably damaging Het
Pou6f2 C A 13: 18,553,092 (GRCm39) A81S Het
Ppl T A 16: 4,905,828 (GRCm39) E1489V probably damaging Het
Ptpdc1 A G 13: 48,733,264 (GRCm39) F792S probably damaging Het
Pus1 A G 5: 110,927,582 (GRCm39) Y58H probably damaging Het
Rex2 C A 4: 147,142,547 (GRCm39) T345N possibly damaging Het
Rnf144a T C 12: 26,389,439 (GRCm39) M1V probably null Het
Siglec15 A T 18: 78,100,445 (GRCm39) C13* probably null Het
Skint10 G A 4: 112,632,003 (GRCm39) Q6* probably null Het
Slc5a1 T C 5: 33,304,057 (GRCm39) W291R probably damaging Het
Snx27 A G 3: 94,426,366 (GRCm39) F378L probably benign Het
Strip2 A T 6: 29,923,928 (GRCm39) T81S probably benign Het
Tas2r143 A G 6: 42,377,656 (GRCm39) N162S probably damaging Het
Tatdn1 T C 15: 58,776,607 (GRCm39) D256G probably benign Het
Tbc1d5 A G 17: 51,089,291 (GRCm39) S630P probably damaging Het
Tlr11 A G 14: 50,598,611 (GRCm39) D199G probably benign Het
Tmed8 C A 12: 87,246,991 (GRCm39) probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Ttll3 TAA TAAAGCAA 6: 113,376,123 (GRCm39) probably null Het
U2af2 T C 7: 5,077,661 (GRCm39) probably null Het
Ywhag C T 5: 135,940,394 (GRCm39) E67K probably damaging Het
Zfp105 A G 9: 122,759,808 (GRCm39) H493R probably damaging Het
Zfp426 A T 9: 20,381,446 (GRCm39) C514S probably damaging Het
Zfp536 T A 7: 37,269,113 (GRCm39) D101V probably damaging Het
Other mutations in Mknk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Mknk2 APN 10 80,503,498 (GRCm39) splice site probably benign
IGL02471:Mknk2 APN 10 80,503,955 (GRCm39) missense probably damaging 0.99
IGL02643:Mknk2 APN 10 80,504,435 (GRCm39) missense probably damaging 1.00
H8562:Mknk2 UTSW 10 80,504,768 (GRCm39) splice site probably benign
IGL03052:Mknk2 UTSW 10 80,505,496 (GRCm39) missense probably benign 0.12
R0645:Mknk2 UTSW 10 80,507,742 (GRCm39) splice site probably null
R2061:Mknk2 UTSW 10 80,507,391 (GRCm39) critical splice donor site probably null
R2105:Mknk2 UTSW 10 80,504,435 (GRCm39) missense possibly damaging 0.90
R2167:Mknk2 UTSW 10 80,504,535 (GRCm39) missense probably damaging 1.00
R3847:Mknk2 UTSW 10 80,503,809 (GRCm39) nonsense probably null
R4649:Mknk2 UTSW 10 80,505,173 (GRCm39) missense probably damaging 1.00
R5062:Mknk2 UTSW 10 80,507,603 (GRCm39) missense probably damaging 1.00
R5358:Mknk2 UTSW 10 80,507,597 (GRCm39) missense probably benign 0.19
R5433:Mknk2 UTSW 10 80,503,059 (GRCm39) missense probably benign 0.00
R5518:Mknk2 UTSW 10 80,504,475 (GRCm39) missense possibly damaging 0.92
R5813:Mknk2 UTSW 10 80,511,696 (GRCm39) missense probably benign 0.34
R6060:Mknk2 UTSW 10 80,507,468 (GRCm39) missense probably benign 0.00
R6151:Mknk2 UTSW 10 80,504,859 (GRCm39) splice site probably null
R6366:Mknk2 UTSW 10 80,507,767 (GRCm39) missense probably damaging 0.99
R7640:Mknk2 UTSW 10 80,504,400 (GRCm39) missense probably benign 0.00
R7943:Mknk2 UTSW 10 80,511,701 (GRCm39) missense probably benign 0.00
R8075:Mknk2 UTSW 10 80,507,982 (GRCm39) intron probably benign
R9114:Mknk2 UTSW 10 80,504,823 (GRCm39) missense probably damaging 1.00
R9140:Mknk2 UTSW 10 80,507,427 (GRCm39) missense probably benign 0.22
R9451:Mknk2 UTSW 10 80,505,496 (GRCm39) missense probably benign 0.12
R9506:Mknk2 UTSW 10 80,503,918 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCACTTGCTTTCAATAGCGG -3'
(R):5'- GTGACAGTAATCCATCCTATCCCC -3'

Sequencing Primer
(F):5'- CACTTGCTTTCAATAGCGGCAAAG -3'
(R):5'- TATCCCCAGGAACAGCTGTG -3'
Posted On 2019-12-03