Incidental Mutation 'R7827:Dcpp2'
ID602287
Institutional Source Beutler Lab
Gene Symbol Dcpp2
Ensembl Gene ENSMUSG00000096278
Gene Namedemilune cell and parotid protein 2
SynonymsEG630537
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7827 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location23880880-23900787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 23900592 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 127 (Y127D)
Ref Sequence ENSEMBL: ENSMUSP00000126379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088598] [ENSMUST00000168272]
Predicted Effect probably damaging
Transcript: ENSMUST00000088598
AA Change: Y127D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000085966
Gene: ENSMUSG00000096278
AA Change: Y127D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Jacalin 32 159 2.91e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168272
AA Change: Y127D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126379
Gene: ENSMUSG00000096278
AA Change: Y127D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Jacalin 32 159 2.91e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,414,678 probably benign Het
Abcb1b T C 5: 8,837,747 S878P probably damaging Het
Adamts20 T C 15: 94,325,933 R1305G probably damaging Het
Adcy2 A T 13: 68,689,281 C650S probably damaging Het
Ahnak A T 19: 9,005,344 K1331* probably null Het
Alpk1 A T 3: 127,680,051 S768T probably benign Het
Ap4b1 T G 3: 103,815,082 L124R probably damaging Het
Arrdc2 A T 8: 70,839,394 F3Y probably damaging Het
Atp9a A G 2: 168,705,194 V155A probably benign Het
Bptf A G 11: 107,047,187 S87P probably benign Het
Carmil1 A T 13: 24,036,438 M697K probably benign Het
Ccdc42 G A 11: 68,594,196 V32M probably benign Het
Ces1d A G 8: 93,197,666 probably null Het
Col4a3bp A G 13: 96,617,055 H391R probably damaging Het
Def8 C A 8: 123,447,321 T7K probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
En2 G A 5: 28,166,596 G24S probably benign Het
Evi2a T C 11: 79,527,862 probably benign Het
Fam117b A T 1: 59,913,678 H172L possibly damaging Het
Fam169b A G 7: 68,304,590 I67M probably benign Het
Fbxo40 T A 16: 36,969,499 E416D probably damaging Het
Gja8 T A 3: 96,920,319 N9I possibly damaging Het
Gm5538 A G 3: 59,743,691 N78S probably damaging Het
Gsg1l2 T A 11: 67,785,271 C154S probably benign Het
Hdhd3 C A 4: 62,499,995 probably benign Het
Hunk C T 16: 90,481,326 P341L possibly damaging Het
Ighv8-5 T C 12: 115,067,638 T94A possibly damaging Het
Ints3 T C 3: 90,424,012 N75D probably benign Het
Krt39 T C 11: 99,519,075 E212G probably damaging Het
Ldlrad4 A G 18: 68,254,424 H269R probably damaging Het
Lrrc2 T A 9: 110,960,981 V102E possibly damaging Het
Ltbp2 T A 12: 84,789,881 I1292L probably benign Het
Mad2l1bp A T 17: 46,148,067 V179E possibly damaging Het
Map3k1 A G 13: 111,756,129 V864A probably benign Het
Mapk8ip2 T G 15: 89,458,119 V511G probably damaging Het
Mknk2 A C 10: 80,667,187 S434A probably benign Het
Mllt11 A G 3: 95,220,237 F74S probably damaging Het
Muc16 G T 9: 18,595,223 T6412K possibly damaging Het
Nek5 C A 8: 22,083,387 A518S possibly damaging Het
Npy1r T C 8: 66,704,212 F95L possibly damaging Het
Nup98 G A 7: 102,124,362 T1586I probably benign Het
Olfr128 T A 17: 37,923,677 L37* probably null Het
Olfr1477 T G 19: 13,503,223 N293K probably damaging Het
Olfr303 T A 7: 86,394,557 K314* probably null Het
Olfr702 A G 7: 106,823,725 M267T probably benign Het
Olig3 A T 10: 19,356,770 M48L probably benign Het
Pcdhb16 A G 18: 37,478,851 D288G possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Phip T C 9: 82,908,833 I687V probably benign Het
Piezo1 G A 8: 122,482,920 T2348M probably damaging Het
Plod3 A G 5: 136,989,981 T291A probably benign Het
Pmpca G A 2: 26,390,132 V89I possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Pou6f2 C A 13: 18,378,507 A81S Het
Ppl T A 16: 5,087,964 E1489V probably damaging Het
Ptpdc1 A G 13: 48,579,788 F792S probably damaging Het
Pus1 A G 5: 110,779,716 Y58H probably damaging Het
Rex2 C A 4: 147,058,090 T345N possibly damaging Het
Rnf144a T C 12: 26,339,440 M1V probably null Het
Siglec15 A T 18: 78,057,230 C13* probably null Het
Skint10 G A 4: 112,774,806 Q6* probably null Het
Slc5a1 T C 5: 33,146,713 W291R probably damaging Het
Snx27 A G 3: 94,519,059 F378L probably benign Het
Strip2 A T 6: 29,923,929 T81S probably benign Het
Tas2r143 A G 6: 42,400,722 N162S probably damaging Het
Tatdn1 T C 15: 58,904,758 D256G probably benign Het
Tbc1d5 A G 17: 50,782,263 S630P probably damaging Het
Tlr11 A G 14: 50,361,154 D199G probably benign Het
Tmed8 C A 12: 87,200,217 probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 TAA TAAAGCAA 6: 113,399,162 probably null Het
U2af2 T C 7: 5,074,662 probably null Het
Ywhag C T 5: 135,911,540 E67K probably damaging Het
Zfp105 A G 9: 122,930,743 H493R probably damaging Het
Zfp426 A T 9: 20,470,150 C514S probably damaging Het
Zfp536 T A 7: 37,569,688 D101V probably damaging Het
Other mutations in Dcpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Dcpp2 APN 17 23900635 missense possibly damaging 0.82
R1183:Dcpp2 UTSW 17 23900494 missense probably benign 0.06
R1482:Dcpp2 UTSW 17 23900542 missense probably damaging 1.00
R2193:Dcpp2 UTSW 17 23900419 missense probably damaging 0.98
R3983:Dcpp2 UTSW 17 23900573 nonsense probably null
R5426:Dcpp2 UTSW 17 23899313 missense possibly damaging 0.92
R5554:Dcpp2 UTSW 17 23900571 missense probably damaging 0.99
R6042:Dcpp2 UTSW 17 23898912 missense probably damaging 0.99
R6734:Dcpp2 UTSW 17 23900571 missense probably damaging 0.99
R8220:Dcpp2 UTSW 17 23900692 missense possibly damaging 0.89
R8283:Dcpp2 UTSW 17 23899410 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCAAGTGTATGGCTCTACTGC -3'
(R):5'- TCTCAGACCCAAGGATTGCAG -3'

Sequencing Primer
(F):5'- CTCTACTGCCGGGAAGGTGATG -3'
(R):5'- GATTGCAGTTGGACACACAGCTC -3'
Posted On2019-12-03