Incidental Mutation 'R7829:Nbeal1'
ID602298
Institutional Source Beutler Lab
Gene Symbol Nbeal1
Ensembl Gene ENSMUSG00000073664
Gene Nameneurobeachin like 1
SynonymsA530083I02Rik, A530050O19Rik, ALS2CR17, 2310076G13Rik
MMRRC Submission
Accession Numbers

Genbank: NM_173444; MGI: 2444343

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7829 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location60180599-60338328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 60237151 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 684 (V684L)
Ref Sequence ENSEMBL: ENSMUSP00000124056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160834] [ENSMUST00000160980]
Predicted Effect probably benign
Transcript: ENSMUST00000160834
AA Change: V684L

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124056
Gene: ENSMUSG00000073664
AA Change: V684L

DomainStartEndE-ValueType
low complexity region 522 541 N/A INTRINSIC
Pfam:Laminin_G_3 567 801 8.3e-9 PFAM
low complexity region 1383 1401 N/A INTRINSIC
low complexity region 1849 1865 N/A INTRINSIC
Pfam:PH_BEACH 1882 1975 4.9e-32 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160980
SMART Domains Protein: ENSMUSP00000125147
Gene: ENSMUSG00000073664

DomainStartEndE-ValueType
low complexity region 278 297 N/A INTRINSIC
Meta Mutation Damage Score 0.1198 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (61/63)
Allele List at MGI

All alleles(16) : Targeted(1) Gene trapped(15)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C G 11: 58,879,997 L102V not run Het
Abca12 A T 1: 71,292,421 S1323R probably benign Het
Abcb1a T A 5: 8,698,623 I318N probably benign Het
Adam10 A T 9: 70,766,927 K524* probably null Het
Adamts3 C T 5: 89,861,490 G105R probably damaging Het
Adcy7 T C 8: 88,315,759 I418T probably damaging Het
Alg9 T A 9: 50,788,171 F165L probably damaging Het
Anapc2 G T 2: 25,277,741 R440L probably damaging Het
Arhgef17 A T 7: 100,876,845 H1876Q probably benign Het
Armc2 G A 10: 41,926,860 R606C probably benign Het
Cd163 T C 6: 124,304,779 S14P probably benign Het
Cfap74 T C 4: 155,429,237 V502A Het
Copb2 T C 9: 98,588,094 I891T probably damaging Het
Creb3 T C 4: 43,566,322 L276P probably damaging Het
Crnkl1 T A 2: 145,931,349 M126L probably benign Het
Csrp2 C T 10: 110,935,184 A50V probably damaging Het
Ctsd A G 7: 142,377,142 C284R probably damaging Het
Dll3 G A 7: 28,294,650 A454V probably damaging Het
Dmbx1 C T 4: 115,923,907 probably benign Het
Dnah6 C A 6: 73,127,919 E1896* probably null Het
Dtwd1 A G 2: 126,164,759 T234A probably damaging Het
Fhod3 G A 18: 25,115,890 probably null Het
Gm10549 C A 18: 33,464,410 probably benign Het
Gm7298 T C 6: 121,765,338 I495T probably damaging Het
Grhl3 T C 4: 135,561,221 N51S probably damaging Het
Gtpbp4 A T 13: 8,985,330 probably null Het
Hsd17b14 A C 7: 45,566,785 S260R probably benign Het
Insig2 A T 1: 121,307,329 probably null Het
Itgae T A 11: 73,138,792 V1046D probably benign Het
Kif1b A T 4: 149,220,990 probably null Het
Kmo A G 1: 175,650,659 probably null Het
Loxhd1 A G 18: 77,408,787 N29S probably damaging Het
Lrp1b A T 2: 40,903,448 C2484* probably null Het
Lrrc23 T A 6: 124,770,748 M293L probably benign Het
Mphosph6 T C 8: 117,799,068 D47G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naglu G A 11: 101,076,610 R462H probably damaging Het
Nlrc5 T C 8: 94,521,769 S1711P probably damaging Het
Olfr129 T C 17: 38,055,329 Y79C possibly damaging Het
Olfr420 A T 1: 174,158,859 I29F probably benign Het
Olfr97 T C 17: 37,232,310 E20G probably benign Het
Osbpl6 G A 2: 76,593,387 A857T probably damaging Het
Oscp1 C A 4: 126,088,408 D380E probably benign Het
Pdzd7 C A 19: 45,039,239 R265S probably benign Het
Piezo2 A T 18: 63,113,876 probably null Het
Pigc G A 1: 161,970,464 R5H probably benign Het
Pla2g5 C A 4: 138,804,534 R53L probably benign Het
Rbm6 T C 9: 107,852,706 R248G probably damaging Het
Rev1 A T 1: 38,056,445 L877Q probably damaging Het
Rpap3 A T 15: 97,681,708 N474K probably benign Het
Ryr2 T A 13: 11,827,607 E468V possibly damaging Het
Samd9l A C 6: 3,374,749 D837E probably benign Het
Sipa1l2 T C 8: 125,451,988 N1124S probably damaging Het
Slc11a2 G A 15: 100,409,261 A83V possibly damaging Het
Slfn14 A G 11: 83,281,817 probably null Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Suclg1 A G 6: 73,275,243 probably null Het
Syne1 A C 10: 5,342,293 V1325G probably damaging Het
Tmprss15 T C 16: 78,987,650 S706G probably benign Het
Tox2 T C 2: 163,320,376 Y389H probably damaging Het
Trappc10 T C 10: 78,199,075 T946A probably benign Het
Ubqln1 C T 13: 58,177,905 E546K probably damaging Het
Zfp106 A G 2: 120,524,057 V1411A possibly damaging Het
Zkscan5 A T 5: 145,218,703 K395* probably null Het
Other mutations in Nbeal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nbeal1 APN 1 60235191 nonsense probably null 0.00
IGL00334:Nbeal1 APN 1 60281883 missense probably damaging 0.98
IGL00334:Nbeal1 APN 1 60328103 missense probably damaging 1.00
IGL00514:Nbeal1 APN 1 60217225 missense probably benign 0.31
IGL00596:Nbeal1 APN 1 60181741 missense probably damaging 0.96
IGL00654:Nbeal1 APN 1 60195011 critical splice acceptor site probably benign 0.00
IGL00757:Nbeal1 APN 1 60195143 missense possibly damaging 0.82
IGL00771:Nbeal1 APN 1 60235353 missense probably benign 0.11
IGL01315:Nbeal1 APN 1 60281341 missense probably damaging 1.00
IGL01445:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01456:Nbeal1 APN 1 60230628 missense probably damaging 1.00
IGL01458:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01535:Nbeal1 APN 1 60217255 missense probably damaging 1.00
IGL01608:Nbeal1 APN 1 60242535 critical splice acceptor site probably benign 0.00
IGL02006:Nbeal1 APN 1 60272259 critical splice donor site probably null
IGL02105:Nbeal1 APN 1 60253501 missense probably damaging 1.00
IGL02409:Nbeal1 APN 1 60329335 missense probably benign 0.01
IGL02713:Nbeal1 APN 1 60235237 missense possibly damaging 0.94
IGL02720:Nbeal1 APN 1 60283987 missense probably damaging 0.98
IGL02887:Nbeal1 APN 1 60287444 splice site probably benign
IGL02945:Nbeal1 APN 1 60206410 missense probably damaging 1.00
IGL03023:Nbeal1 APN 1 60253413 missense probably damaging 0.98
IGL03114:Nbeal1 APN 1 60278727 missense probably damaging 1.00
IGL03231:Nbeal1 APN 1 60236459 missense probably benign 0.44
IGL03241:Nbeal1 APN 1 60234868 missense possibly damaging 0.46
IGL03241:Nbeal1 APN 1 60234869 missense probably benign 0.44
IGL03382:Nbeal1 APN 1 60261586 critical splice donor site probably null
IGL03412:Nbeal1 APN 1 60242567 nonsense probably null
coach UTSW 1 60253481 nonsense probably null
Committee UTSW 1 60292903 missense probably damaging 1.00
Disgrace UTSW 1 60281310 nonsense probably null
Dravrah UTSW 1 60284092 missense probably damaging 1.00
Harvard UTSW 1 60235563 splice site probably null
horrified UTSW 1 60244824 missense probably damaging 1.00
Lampoon UTSW 1 60261586 critical splice donor site probably null
lawyer UTSW 1 60310224 nonsense probably null
magistrate UTSW 1 60194597 critical splice donor site probably null
National UTSW 1 60222263 missense possibly damaging 0.95
phainopepla UTSW 1 60319687 missense probably damaging 1.00
silky UTSW 1 60330878 splice site probably benign
stiggs UTSW 1 60237151 missense probably benign 0.11
3-1:Nbeal1 UTSW 1 60264272 splice site probably benign
P0007:Nbeal1 UTSW 1 60319688 missense probably damaging 0.98
P0028:Nbeal1 UTSW 1 60291937 missense probably damaging 1.00
R0041:Nbeal1 UTSW 1 60281871 missense probably benign 0.05
R0051:Nbeal1 UTSW 1 60310263 missense probably benign 0.19
R0052:Nbeal1 UTSW 1 60228612 splice site probably benign
R0054:Nbeal1 UTSW 1 60287401 utr 3 prime probably benign
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0094:Nbeal1 UTSW 1 60305309 missense possibly damaging 0.62
R0310:Nbeal1 UTSW 1 60305370 splice site probably benign
R0324:Nbeal1 UTSW 1 60292873 missense probably damaging 1.00
R0329:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0330:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0417:Nbeal1 UTSW 1 60247734 missense probably benign 0.00
R0421:Nbeal1 UTSW 1 60268439 missense probably benign 0.08
R0617:Nbeal1 UTSW 1 60281832 nonsense probably null
R1034:Nbeal1 UTSW 1 60290006 nonsense probably null
R1082:Nbeal1 UTSW 1 60312226 missense probably damaging 0.99
R1123:Nbeal1 UTSW 1 60260269 missense probably benign
R1187:Nbeal1 UTSW 1 60194528 missense probably damaging 1.00
R1484:Nbeal1 UTSW 1 60200939 missense probably damaging 1.00
R1594:Nbeal1 UTSW 1 60305291 missense possibly damaging 0.91
R1651:Nbeal1 UTSW 1 60200119 missense probably damaging 1.00
R1678:Nbeal1 UTSW 1 60260334 missense probably benign 0.00
R1806:Nbeal1 UTSW 1 60284092 missense probably damaging 1.00
R1937:Nbeal1 UTSW 1 60267941 nonsense probably null
R1952:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R1953:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R2038:Nbeal1 UTSW 1 60206344 missense probably benign 0.00
R2044:Nbeal1 UTSW 1 60319687 missense probably damaging 1.00
R2050:Nbeal1 UTSW 1 60292964 splice site probably null
R2055:Nbeal1 UTSW 1 60311057 missense probably damaging 1.00
R2064:Nbeal1 UTSW 1 60270356 missense possibly damaging 0.89
R2100:Nbeal1 UTSW 1 60305271 splice site probably null
R2181:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R2192:Nbeal1 UTSW 1 60281895 missense probably damaging 1.00
R2203:Nbeal1 UTSW 1 60284006 missense probably benign 0.21
R2267:Nbeal1 UTSW 1 60330878 splice site probably benign
R2268:Nbeal1 UTSW 1 60330878 splice site probably benign
R2351:Nbeal1 UTSW 1 60237098 missense possibly damaging 0.90
R2366:Nbeal1 UTSW 1 60251352 missense probably damaging 0.97
R2393:Nbeal1 UTSW 1 60251370 missense probably damaging 0.98
R3545:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3546:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3547:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3701:Nbeal1 UTSW 1 60251413 splice site probably benign
R3747:Nbeal1 UTSW 1 60195023 missense probably damaging 0.98
R3875:Nbeal1 UTSW 1 60194599 splice site probably benign
R4119:Nbeal1 UTSW 1 60291870 missense probably damaging 0.99
R4256:Nbeal1 UTSW 1 60330948 missense probably benign 0.19
R4371:Nbeal1 UTSW 1 60289946 missense possibly damaging 0.95
R4450:Nbeal1 UTSW 1 60267774 missense probably damaging 0.97
R4558:Nbeal1 UTSW 1 60281310 nonsense probably null
R4618:Nbeal1 UTSW 1 60228731 intron probably benign
R4673:Nbeal1 UTSW 1 60329390 missense probably damaging 1.00
R4719:Nbeal1 UTSW 1 60235563 splice site probably null
R4798:Nbeal1 UTSW 1 60222193 splice site probably null
R4826:Nbeal1 UTSW 1 60251342 missense possibly damaging 0.79
R4841:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4842:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4895:Nbeal1 UTSW 1 60292903 missense probably damaging 1.00
R4929:Nbeal1 UTSW 1 60238654 missense probably damaging 1.00
R5026:Nbeal1 UTSW 1 60237179 missense probably damaging 1.00
R5243:Nbeal1 UTSW 1 60270328 missense probably damaging 0.99
R5300:Nbeal1 UTSW 1 60235559 nonsense probably null
R5345:Nbeal1 UTSW 1 60328210 critical splice donor site probably null
R5502:Nbeal1 UTSW 1 60310999 missense probably damaging 1.00
R5542:Nbeal1 UTSW 1 60277194 missense probably benign 0.00
R5555:Nbeal1 UTSW 1 60237152 missense possibly damaging 0.93
R5580:Nbeal1 UTSW 1 60242602 missense probably benign 0.45
R5765:Nbeal1 UTSW 1 60291847 missense probably damaging 1.00
R5802:Nbeal1 UTSW 1 60272221 missense probably benign 0.01
R5907:Nbeal1 UTSW 1 60228791 intron probably benign
R5918:Nbeal1 UTSW 1 60267892 missense possibly damaging 0.90
R5923:Nbeal1 UTSW 1 60248395 missense probably damaging 1.00
R6066:Nbeal1 UTSW 1 60248405 missense probably benign 0.29
R6091:Nbeal1 UTSW 1 60181556 start gained probably benign
R6113:Nbeal1 UTSW 1 60222263 missense possibly damaging 0.95
R6143:Nbeal1 UTSW 1 60251307 missense possibly damaging 0.81
R6194:Nbeal1 UTSW 1 60257484 missense possibly damaging 0.80
R6197:Nbeal1 UTSW 1 60222128 missense probably damaging 0.99
R6228:Nbeal1 UTSW 1 60295924 missense probably benign 0.00
R6229:Nbeal1 UTSW 1 60248365 missense possibly damaging 0.88
R6309:Nbeal1 UTSW 1 60238719 missense probably benign
R6457:Nbeal1 UTSW 1 60253474 missense probably benign 0.31
R6489:Nbeal1 UTSW 1 60330942 missense possibly damaging 0.89
R6845:Nbeal1 UTSW 1 60281310 nonsense probably null
R7021:Nbeal1 UTSW 1 60261586 critical splice donor site probably null
R7033:Nbeal1 UTSW 1 60310947 missense probably damaging 1.00
R7144:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7145:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7146:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7157:Nbeal1 UTSW 1 60237158 missense probably damaging 1.00
R7157:Nbeal1 UTSW 1 60260634 nonsense probably null
R7209:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7210:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7211:Nbeal1 UTSW 1 60200951 missense probably damaging 1.00
R7212:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7213:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7214:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7283:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7285:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7287:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7296:Nbeal1 UTSW 1 60310224 nonsense probably null
R7312:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7313:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7329:Nbeal1 UTSW 1 60217196 missense probably benign 0.39
R7380:Nbeal1 UTSW 1 60244810 missense probably damaging 1.00
R7414:Nbeal1 UTSW 1 60194597 critical splice donor site probably null
R7477:Nbeal1 UTSW 1 60261584 missense probably benign
R7507:Nbeal1 UTSW 1 60235467 missense probably damaging 1.00
R7642:Nbeal1 UTSW 1 60277227 missense probably benign 0.31
R7678:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7689:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7728:Nbeal1 UTSW 1 60244824 missense probably damaging 1.00
R7757:Nbeal1 UTSW 1 60257450 missense probably damaging 0.97
R7761:Nbeal1 UTSW 1 60319341 missense probably benign 0.00
R7813:Nbeal1 UTSW 1 60291889 missense probably damaging 1.00
R7891:Nbeal1 UTSW 1 60260432 missense probably benign
R7902:Nbeal1 UTSW 1 60291870 missense probably damaging 0.99
R8022:Nbeal1 UTSW 1 60260272 nonsense probably null
R8053:Nbeal1 UTSW 1 60279795 missense probably damaging 0.98
R8169:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R8170:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R8178:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R8182:Nbeal1 UTSW 1 60200133 missense probably benign 0.00
R8186:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R8187:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R8193:Nbeal1 UTSW 1 60253481 nonsense probably null
R8209:Nbeal1 UTSW 1 60277177 missense probably damaging 0.99
R8226:Nbeal1 UTSW 1 60277177 missense probably damaging 0.99
X0022:Nbeal1 UTSW 1 60277232 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTTTGAAGATTTCCTAGGCTGG -3'
(R):5'- TGCTGAACCTACTTCTCCAAAC -3'

Sequencing Primer
(F):5'- TGTTAAACCAGTTATCTCTGTTGC -3'
(R):5'- ACATCTGAAATTATCTAATGGCAGAC -3'
Posted On2019-12-03