Incidental Mutation 'R7829:Adamts3'
ID 602316
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms 1100001H14Rik, 6330442E02Rik
MMRRC Submission 045883-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7829 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 89824946-90031193 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 90009349 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 105 (G105R)
Ref Sequence ENSEMBL: ENSMUSP00000142771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159] [ENSMUST00000198151]
AlphaFold E9Q287
Predicted Effect probably benign
Transcript: ENSMUST00000061427
AA Change: G105R

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: G105R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163159
AA Change: G105R

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: G105R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198151
AA Change: G105R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142771
Gene: ENSMUSG00000043635
AA Change: G105R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 174 2.3e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C G 11: 58,770,823 (GRCm39) L102V not run Het
Abca12 A T 1: 71,331,580 (GRCm39) S1323R probably benign Het
Abcb1a T A 5: 8,748,623 (GRCm39) I318N probably benign Het
Adam10 A T 9: 70,674,209 (GRCm39) K524* probably null Het
Adcy7 T C 8: 89,042,387 (GRCm39) I418T probably damaging Het
Alg9 T A 9: 50,699,471 (GRCm39) F165L probably damaging Het
Anapc2 G T 2: 25,167,753 (GRCm39) R440L probably damaging Het
Arhgef17 A T 7: 100,526,052 (GRCm39) H1876Q probably benign Het
Armc2 G A 10: 41,802,856 (GRCm39) R606C probably benign Het
Cd163 T C 6: 124,281,738 (GRCm39) S14P probably benign Het
Cfap74 T C 4: 155,513,694 (GRCm39) V502A Het
Copb2 T C 9: 98,470,147 (GRCm39) I891T probably damaging Het
Creb3 T C 4: 43,566,322 (GRCm39) L276P probably damaging Het
Crnkl1 T A 2: 145,773,269 (GRCm39) M126L probably benign Het
Csrp2 C T 10: 110,771,045 (GRCm39) A50V probably damaging Het
Ctsd A G 7: 141,930,879 (GRCm39) C284R probably damaging Het
Dll3 G A 7: 27,994,075 (GRCm39) A454V probably damaging Het
Dmbx1 C T 4: 115,781,104 (GRCm39) probably benign Het
Dnah6 C A 6: 73,104,902 (GRCm39) E1896* probably null Het
Dtwd1 A G 2: 126,006,679 (GRCm39) T234A probably damaging Het
Fhod3 G A 18: 25,248,947 (GRCm39) probably null Het
Gm10549 C A 18: 33,597,463 (GRCm39) probably benign Het
Gm7298 T C 6: 121,742,297 (GRCm39) I495T probably damaging Het
Grhl3 T C 4: 135,288,532 (GRCm39) N51S probably damaging Het
Gtpbp4 A T 13: 9,035,366 (GRCm39) probably null Het
Hsd17b14 A C 7: 45,216,209 (GRCm39) S260R probably benign Het
Insig2 A T 1: 121,235,058 (GRCm39) probably null Het
Itgae T A 11: 73,029,618 (GRCm39) V1046D probably benign Het
Kif1b A T 4: 149,305,447 (GRCm39) probably null Het
Kmo A G 1: 175,478,225 (GRCm39) probably null Het
Loxhd1 A G 18: 77,496,483 (GRCm39) N29S probably damaging Het
Lrp1b A T 2: 40,793,460 (GRCm39) C2484* probably null Het
Lrrc23 T A 6: 124,747,711 (GRCm39) M293L probably benign Het
Mphosph6 T C 8: 118,525,807 (GRCm39) D47G probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Naglu G A 11: 100,967,436 (GRCm39) R462H probably damaging Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Nlrc5 T C 8: 95,248,397 (GRCm39) S1711P probably damaging Het
Or10al7 T C 17: 38,366,220 (GRCm39) Y79C possibly damaging Het
Or1o2 T C 17: 37,543,201 (GRCm39) E20G probably benign Het
Or6k2 A T 1: 173,986,425 (GRCm39) I29F probably benign Het
Osbpl6 G A 2: 76,423,731 (GRCm39) A857T probably damaging Het
Oscp1 C A 4: 125,982,201 (GRCm39) D380E probably benign Het
Pdzd7 C A 19: 45,027,678 (GRCm39) R265S probably benign Het
Piezo2 A T 18: 63,246,947 (GRCm39) probably null Het
Pigc G A 1: 161,798,033 (GRCm39) R5H probably benign Het
Pla2g5 C A 4: 138,531,845 (GRCm39) R53L probably benign Het
Rbm6 T C 9: 107,729,905 (GRCm39) R248G probably damaging Het
Rev1 A T 1: 38,095,526 (GRCm39) L877Q probably damaging Het
Rpap3 A T 15: 97,579,589 (GRCm39) N474K probably benign Het
Ryr2 T A 13: 11,842,493 (GRCm39) E468V possibly damaging Het
Samd9l A C 6: 3,374,749 (GRCm39) D837E probably benign Het
Sipa1l2 T C 8: 126,178,727 (GRCm39) N1124S probably damaging Het
Slc11a2 G A 15: 100,307,142 (GRCm39) A83V possibly damaging Het
Slfn14 A G 11: 83,172,643 (GRCm39) probably null Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Suclg1 A G 6: 73,252,226 (GRCm39) probably null Het
Syne1 A C 10: 5,292,293 (GRCm39) V1325G probably damaging Het
Tmprss15 T C 16: 78,784,538 (GRCm39) S706G probably benign Het
Tox2 T C 2: 163,162,296 (GRCm39) Y389H probably damaging Het
Trappc10 T C 10: 78,034,909 (GRCm39) T946A probably benign Het
Ubqln1 C T 13: 58,325,719 (GRCm39) E546K probably damaging Het
Zfp106 A G 2: 120,354,538 (GRCm39) V1411A possibly damaging Het
Zkscan5 A T 5: 145,155,513 (GRCm39) K395* probably null Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 90,009,184 (GRCm39) missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89,849,525 (GRCm39) missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89,832,235 (GRCm39) missense probably benign 0.06
IGL01420:Adamts3 APN 5 89,850,916 (GRCm39) missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89,850,802 (GRCm39) missense probably benign 0.14
IGL01676:Adamts3 APN 5 90,029,402 (GRCm39) missense possibly damaging 0.54
IGL01676:Adamts3 APN 5 89,825,613 (GRCm39) missense probably benign 0.00
IGL01678:Adamts3 APN 5 89,855,715 (GRCm39) missense probably damaging 1.00
IGL01936:Adamts3 APN 5 90,009,282 (GRCm39) missense probably benign 0.00
IGL01956:Adamts3 APN 5 89,825,770 (GRCm39) missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89,839,332 (GRCm39) splice site probably null
IGL02415:Adamts3 APN 5 89,854,506 (GRCm39) splice site probably null
IGL03261:Adamts3 APN 5 90,030,756 (GRCm39) utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89,855,263 (GRCm39) missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89,832,326 (GRCm39) missense probably benign
R0079:Adamts3 UTSW 5 89,840,912 (GRCm39) missense probably benign 0.00
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0477:Adamts3 UTSW 5 89,832,366 (GRCm39) missense probably benign
R0605:Adamts3 UTSW 5 90,009,334 (GRCm39) missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89,843,952 (GRCm39) splice site probably benign
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1621:Adamts3 UTSW 5 89,869,560 (GRCm39) missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89,923,280 (GRCm39) missense probably benign 0.00
R2163:Adamts3 UTSW 5 89,856,577 (GRCm39) missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89,849,630 (GRCm39) missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2921:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89,849,592 (GRCm39) missense probably benign 0.04
R3431:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3432:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3813:Adamts3 UTSW 5 89,825,785 (GRCm39) missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89,853,123 (GRCm39) missense probably damaging 0.99
R3905:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3906:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3907:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3908:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89,848,346 (GRCm39) missense probably benign 0.03
R4684:Adamts3 UTSW 5 89,850,866 (GRCm39) missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89,825,675 (GRCm39) missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89,832,182 (GRCm39) missense probably benign 0.01
R5097:Adamts3 UTSW 5 89,840,909 (GRCm39) missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89,856,502 (GRCm39) missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89,923,236 (GRCm39) missense probably benign
R5265:Adamts3 UTSW 5 90,009,411 (GRCm39) missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89,855,159 (GRCm39) splice site probably null
R5413:Adamts3 UTSW 5 89,856,626 (GRCm39) missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89,839,332 (GRCm39) splice site probably null
R5738:Adamts3 UTSW 5 89,856,527 (GRCm39) missense probably damaging 1.00
R5979:Adamts3 UTSW 5 90,009,528 (GRCm39) missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89,839,194 (GRCm39) missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89,869,673 (GRCm39) missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 90,009,468 (GRCm39) missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 90,009,354 (GRCm39) missense probably damaging 1.00
R7172:Adamts3 UTSW 5 90,030,860 (GRCm39) start gained probably benign
R7263:Adamts3 UTSW 5 89,825,601 (GRCm39) missense probably benign 0.03
R7401:Adamts3 UTSW 5 89,855,309 (GRCm39) critical splice acceptor site probably null
R7599:Adamts3 UTSW 5 90,009,256 (GRCm39) missense probably benign 0.00
R7835:Adamts3 UTSW 5 89,848,299 (GRCm39) missense possibly damaging 0.70
R7892:Adamts3 UTSW 5 90,009,288 (GRCm39) missense probably benign 0.10
R8021:Adamts3 UTSW 5 89,831,043 (GRCm39) missense possibly damaging 0.47
R8289:Adamts3 UTSW 5 89,923,282 (GRCm39) missense possibly damaging 0.89
R8350:Adamts3 UTSW 5 89,850,815 (GRCm39) missense probably damaging 1.00
R8468:Adamts3 UTSW 5 89,842,627 (GRCm39) missense probably benign 0.19
R8827:Adamts3 UTSW 5 89,839,324 (GRCm39) missense probably benign 0.03
R8864:Adamts3 UTSW 5 89,854,981 (GRCm39) intron probably benign
R8906:Adamts3 UTSW 5 89,825,575 (GRCm39) missense probably damaging 0.98
R9000:Adamts3 UTSW 5 89,854,570 (GRCm39) missense probably benign 0.17
R9005:Adamts3 UTSW 5 89,825,693 (GRCm39) missense probably benign 0.08
R9378:Adamts3 UTSW 5 89,848,269 (GRCm39) nonsense probably null
R9505:Adamts3 UTSW 5 89,855,751 (GRCm39) missense probably damaging 1.00
R9516:Adamts3 UTSW 5 89,834,750 (GRCm39) missense probably damaging 1.00
X0064:Adamts3 UTSW 5 89,850,901 (GRCm39) missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89,832,308 (GRCm39) missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,855,723 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTTCCATGTTCATACAGGAAAGG -3'
(R):5'- TGGTGACACCAGTTAGCACG -3'

Sequencing Primer
(F):5'- GACCATCACAGTTGCTAATGGC -3'
(R):5'- CCAGTTAGCACGAATCTAAAAGG -3'
Posted On 2019-12-03