Mutagenetix > Incidental Mutation

Incidental Mutation 'R7829:Adamts3'

602316

Institutional Source

Beutler Lab

Gene Symbol

Adamts3

Ensembl Gene

ENSMUSG00000043635

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3

Synonyms

6330442E02Rik, 1100001H14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7829 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89677087-89883334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 89861490 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 105 (G105R)

Ref Sequence

ENSEMBL: ENSMUSP00000142771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159] [ENSMUST00000198151]

AlphaFold

E9Q287

Predicted Effect

probably benign
Transcript: ENSMUST00000061427
AA Change: G105R

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: G105R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	201	5.1e-40	PFAM
Pfam:Reprolysin_5	254	439	5.4e-15	PFAM
Pfam:Reprolysin_4	256	454	1.9e-10	PFAM
Pfam:Reprolysin	257	460	3.6e-22	PFAM
Pfam:Reprolysin_2	274	451	7.7e-13	PFAM
Pfam:Reprolysin_3	278	409	1.5e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	827	3e-34	PFAM
TSP1	848	905	4.35e-2	SMART
TSP1	908	967	4.95e-2	SMART
TSP1	969	1016	6.58e-5	SMART
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1157	1177	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163159
AA Change: G105R

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: G105R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	43	201	1.5e-40	PFAM
Pfam:Reprolysin_5	254	439	2.2e-15	PFAM
Pfam:Reprolysin_4	256	454	7.7e-11	PFAM
Pfam:Reprolysin	257	460	3.7e-21	PFAM
Pfam:Reprolysin_2	274	451	4.3e-14	PFAM
Pfam:Reprolysin_3	278	409	1.3e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	828	3.6e-28	PFAM
TSP1	849	906	4.35e-2	SMART
TSP1	909	968	4.95e-2	SMART
TSP1	970	1017	6.58e-5	SMART
low complexity region	1115	1129	N/A	INTRINSIC
low complexity region	1158	1178	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000198151
AA Change: G105R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000142771
Gene: ENSMUSG00000043635
AA Change: G105R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	174	2.3e-29	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

97% (61/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	C	G	11: 58,879,997	L102V	not run	Het
Abca12	A	T	1: 71,292,421	S1323R	probably benign	Het
Abcb1a	T	A	5: 8,698,623	I318N	probably benign	Het
Adam10	A	T	9: 70,766,927	K524*	probably null	Het
Adcy7	T	C	8: 88,315,759	I418T	probably damaging	Het
Alg9	T	A	9: 50,788,171	F165L	probably damaging	Het
Anapc2	G	T	2: 25,277,741	R440L	probably damaging	Het
Arhgef17	A	T	7: 100,876,845	H1876Q	probably benign	Het
Armc2	G	A	10: 41,926,860	R606C	probably benign	Het
Cd163	T	C	6: 124,304,779	S14P	probably benign	Het
Cfap74	T	C	4: 155,429,237	V502A		Het
Copb2	T	C	9: 98,588,094	I891T	probably damaging	Het
Creb3	T	C	4: 43,566,322	L276P	probably damaging	Het
Crnkl1	T	A	2: 145,931,349	M126L	probably benign	Het
Csrp2	C	T	10: 110,935,184	A50V	probably damaging	Het
Ctsd	A	G	7: 142,377,142	C284R	probably damaging	Het
Dll3	G	A	7: 28,294,650	A454V	probably damaging	Het
Dmbx1	C	T	4: 115,923,907		probably benign	Het
Dnah6	C	A	6: 73,127,919	E1896*	probably null	Het
Dtwd1	A	G	2: 126,164,759	T234A	probably damaging	Het
Fhod3	G	A	18: 25,115,890		probably null	Het
Gm10549	C	A	18: 33,464,410		probably benign	Het
Gm7298	T	C	6: 121,765,338	I495T	probably damaging	Het
Grhl3	T	C	4: 135,561,221	N51S	probably damaging	Het
Gtpbp4	A	T	13: 8,985,330		probably null	Het
Hsd17b14	A	C	7: 45,566,785	S260R	probably benign	Het
Insig2	A	T	1: 121,307,329		probably null	Het
Itgae	T	A	11: 73,138,792	V1046D	probably benign	Het
Kif1b	A	T	4: 149,220,990		probably null	Het
Kmo	A	G	1: 175,650,659		probably null	Het
Loxhd1	A	G	18: 77,408,787	N29S	probably damaging	Het
Lrp1b	A	T	2: 40,903,448	C2484*	probably null	Het
Lrrc23	T	A	6: 124,770,748	M293L	probably benign	Het
Mphosph6	T	C	8: 117,799,068	D47G	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naglu	G	A	11: 101,076,610	R462H	probably damaging	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nlrc5	T	C	8: 94,521,769	S1711P	probably damaging	Het
Olfr129	T	C	17: 38,055,329	Y79C	possibly damaging	Het
Olfr420	A	T	1: 174,158,859	I29F	probably benign	Het
Olfr97	T	C	17: 37,232,310	E20G	probably benign	Het
Osbpl6	G	A	2: 76,593,387	A857T	probably damaging	Het
Oscp1	C	A	4: 126,088,408	D380E	probably benign	Het
Pdzd7	C	A	19: 45,039,239	R265S	probably benign	Het
Piezo2	A	T	18: 63,113,876		probably null	Het
Pigc	G	A	1: 161,970,464	R5H	probably benign	Het
Pla2g5	C	A	4: 138,804,534	R53L	probably benign	Het
Rbm6	T	C	9: 107,852,706	R248G	probably damaging	Het
Rev1	A	T	1: 38,056,445	L877Q	probably damaging	Het
Rpap3	A	T	15: 97,681,708	N474K	probably benign	Het
Ryr2	T	A	13: 11,827,607	E468V	possibly damaging	Het
Samd9l	A	C	6: 3,374,749	D837E	probably benign	Het
Sipa1l2	T	C	8: 125,451,988	N1124S	probably damaging	Het
Slc11a2	G	A	15: 100,409,261	A83V	possibly damaging	Het
Slfn14	A	G	11: 83,281,817		probably null	Het
Sry	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	Y: 2,662,638		probably benign	Het
Suclg1	A	G	6: 73,275,243		probably null	Het
Syne1	A	C	10: 5,342,293	V1325G	probably damaging	Het
Tmprss15	T	C	16: 78,987,650	S706G	probably benign	Het
Tox2	T	C	2: 163,320,376	Y389H	probably damaging	Het
Trappc10	T	C	10: 78,199,075	T946A	probably benign	Het
Ubqln1	C	T	13: 58,177,905	E546K	probably damaging	Het
Zfp106	A	G	2: 120,524,057	V1411A	possibly damaging	Het
Zkscan5	A	T	5: 145,218,703	K395*	probably null	Het

Other mutations in Adamts3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Adamts3	APN	5	89861325	missense	probably damaging	1.00
IGL00340:Adamts3	APN	5	89701666	missense	probably damaging	1.00
IGL00923:Adamts3	APN	5	89684376	missense	probably benign	0.06
IGL01420:Adamts3	APN	5	89703057	missense	possibly damaging	0.57
IGL01522:Adamts3	APN	5	89702943	missense	probably benign	0.14
IGL01676:Adamts3	APN	5	89677754	missense	probably benign	0.00
IGL01676:Adamts3	APN	5	89881543	missense	possibly damaging	0.54
IGL01678:Adamts3	APN	5	89707856	missense	probably damaging	1.00
IGL01936:Adamts3	APN	5	89861423	missense	probably benign	0.00
IGL01956:Adamts3	APN	5	89677911	missense	probably damaging	0.99
IGL02342:Adamts3	APN	5	89691473	splice site	probably null
IGL02415:Adamts3	APN	5	89706647	splice site	probably null
IGL03261:Adamts3	APN	5	89882897	utr 5 prime	probably benign
IGL03301:Adamts3	APN	5	89707404	missense	probably damaging	1.00
R0041:Adamts3	UTSW	5	89684467	missense	probably benign
R0079:Adamts3	UTSW	5	89693053	missense	probably benign	0.00
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0477:Adamts3	UTSW	5	89684507	missense	probably benign
R0605:Adamts3	UTSW	5	89861475	missense	possibly damaging	0.96
R1036:Adamts3	UTSW	5	89696093	splice site	probably benign
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1621:Adamts3	UTSW	5	89721701	missense	probably damaging	1.00
R1799:Adamts3	UTSW	5	89775421	missense	probably benign	0.00
R2163:Adamts3	UTSW	5	89708718	missense	probably damaging	0.99
R2412:Adamts3	UTSW	5	89701771	missense	probably damaging	0.99
R2420:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2421:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2422:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2921:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2922:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2923:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R3402:Adamts3	UTSW	5	89701733	missense	probably benign	0.04
R3431:Adamts3	UTSW	5	89707453	splice site	probably benign
R3432:Adamts3	UTSW	5	89707453	splice site	probably benign
R3813:Adamts3	UTSW	5	89677926	missense	possibly damaging	0.67
R3816:Adamts3	UTSW	5	89705264	missense	probably damaging	0.99
R3905:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3906:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3907:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3908:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R4557:Adamts3	UTSW	5	89700487	missense	probably benign	0.03
R4684:Adamts3	UTSW	5	89703007	missense	probably damaging	0.98
R4844:Adamts3	UTSW	5	89677816	missense	probably damaging	0.99
R4925:Adamts3	UTSW	5	89684323	missense	probably benign	0.01
R5097:Adamts3	UTSW	5	89693050	missense	probably damaging	0.97
R5100:Adamts3	UTSW	5	89708643	missense	probably damaging	1.00
R5237:Adamts3	UTSW	5	89775377	missense	probably benign
R5265:Adamts3	UTSW	5	89861552	missense	possibly damaging	0.91
R5322:Adamts3	UTSW	5	89707300	splice site	probably null
R5413:Adamts3	UTSW	5	89708767	missense	probably damaging	1.00
R5459:Adamts3	UTSW	5	89691473	splice site	probably null
R5738:Adamts3	UTSW	5	89708668	missense	probably damaging	1.00
R5979:Adamts3	UTSW	5	89861669	missense	probably damaging	0.96
R5992:Adamts3	UTSW	5	89691335	missense	probably damaging	1.00
R6364:Adamts3	UTSW	5	89721814	missense	possibly damaging	0.92
R6572:Adamts3	UTSW	5	89861609	missense	possibly damaging	0.87
R7098:Adamts3	UTSW	5	89861495	missense	probably damaging	1.00
R7172:Adamts3	UTSW	5	89883001	start gained	probably benign
R7263:Adamts3	UTSW	5	89677742	missense	probably benign	0.03
R7401:Adamts3	UTSW	5	89707450	critical splice acceptor site	probably null
R7599:Adamts3	UTSW	5	89861397	missense	probably benign	0.00
R7835:Adamts3	UTSW	5	89700440	missense	possibly damaging	0.70
R7892:Adamts3	UTSW	5	89861429	missense	probably benign	0.10
R8021:Adamts3	UTSW	5	89683184	missense	possibly damaging	0.47
R8289:Adamts3	UTSW	5	89775423	missense	possibly damaging	0.89
R8350:Adamts3	UTSW	5	89702956	missense	probably damaging	1.00
R8468:Adamts3	UTSW	5	89694768	missense	probably benign	0.19
R8827:Adamts3	UTSW	5	89691465	missense	probably benign	0.03
R8864:Adamts3	UTSW	5	89707122	intron	probably benign
R8906:Adamts3	UTSW	5	89677716	missense	probably damaging	0.98
R9000:Adamts3	UTSW	5	89706711	missense	probably benign	0.17
R9005:Adamts3	UTSW	5	89677834	missense	probably benign	0.08
R9378:Adamts3	UTSW	5	89700410	nonsense	probably null
R9505:Adamts3	UTSW	5	89707892	missense	probably damaging	1.00
R9516:Adamts3	UTSW	5	89686891	missense	probably damaging	1.00
X0064:Adamts3	UTSW	5	89703042	missense	possibly damaging	0.75
Z1088:Adamts3	UTSW	5	89684449	missense	probably damaging	0.99
Z1176:Adamts3	UTSW	5	89775351	missense	not run
Z1177:Adamts3	UTSW	5	89707864	nonsense	probably null
Z1177:Adamts3	UTSW	5	89775351	missense	not run

Predicted Primers

PCR Primer
(F):5'- CCTTCCATGTTCATACAGGAAAGG -3'
(R):5'- TGGTGACACCAGTTAGCACG -3'

Sequencing Primer
(F):5'- GACCATCACAGTTGCTAATGGC -3'
(R):5'- CCAGTTAGCACGAATCTAAAAGG -3'

Posted On

2019-12-03