Mutagenetix > Incidental Mutations

Incidental Mutation 'R7829:Samd9l'

602319

Institutional Source

Beutler Lab

Gene Symbol

Samd9l

Ensembl Gene

ENSMUSG00000047735

Gene Name

sterile alpha motif domain containing 9-like

Synonyms

ESTM25

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7829 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3372257-3399572 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 3374749 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 837 (D837E)

Ref Sequence

ENSEMBL: ENSMUSP00000112688 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]

Predicted Effect

probably benign
Transcript: ENSMUST00000120087
AA Change: D837E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: D837E

Domain	Start	End	E-Value	Type
SCOP:d1kw4a_	8	75	4e-8	SMART
Blast:SAM	11	75	1e-30	BLAST
low complexity region	96	115	N/A	INTRINSIC
low complexity region	385	397	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201638

SMART Domains

Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

Domain	Start	End	E-Value	Type
Pfam:Ste50p-SAM	10	80	1.2e-8	PFAM
Pfam:SAM_2	11	68	8.7e-6	PFAM
Pfam:SAM_1	12	71	2.5e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

97% (61/63)

MGI Phenotype

PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	C	G	11: 58,879,997	L102V	not run	Het
Abca12	A	T	1: 71,292,421	S1323R	probably benign	Het
Abcb1a	T	A	5: 8,698,623	I318N	probably benign	Het
Adam10	A	T	9: 70,766,927	K524*	probably null	Het
Adamts3	C	T	5: 89,861,490	G105R	probably damaging	Het
Adcy7	T	C	8: 88,315,759	I418T	probably damaging	Het
Alg9	T	A	9: 50,788,171	F165L	probably damaging	Het
Anapc2	G	T	2: 25,277,741	R440L	probably damaging	Het
Arhgef17	A	T	7: 100,876,845	H1876Q	probably benign	Het
Armc2	G	A	10: 41,926,860	R606C	probably benign	Het
Cd163	T	C	6: 124,304,779	S14P	probably benign	Het
Cfap74	T	C	4: 155,429,237	V502A		Het
Copb2	T	C	9: 98,588,094	I891T	probably damaging	Het
Creb3	T	C	4: 43,566,322	L276P	probably damaging	Het
Crnkl1	T	A	2: 145,931,349	M126L	probably benign	Het
Csrp2	C	T	10: 110,935,184	A50V	probably damaging	Het
Ctsd	A	G	7: 142,377,142	C284R	probably damaging	Het
Dll3	G	A	7: 28,294,650	A454V	probably damaging	Het
Dmbx1	C	T	4: 115,923,907		probably benign	Het
Dnah6	C	A	6: 73,127,919	E1896*	probably null	Het
Dtwd1	A	G	2: 126,164,759	T234A	probably damaging	Het
Fhod3	G	A	18: 25,115,890		probably null	Het
Gm10549	C	A	18: 33,464,410		probably benign	Het
Gm7298	T	C	6: 121,765,338	I495T	probably damaging	Het
Grhl3	T	C	4: 135,561,221	N51S	probably damaging	Het
Gtpbp4	A	T	13: 8,985,330		probably null	Het
Hsd17b14	A	C	7: 45,566,785	S260R	probably benign	Het
Insig2	A	T	1: 121,307,329		probably null	Het
Itgae	T	A	11: 73,138,792	V1046D	probably benign	Het
Kif1b	A	T	4: 149,220,990		probably null	Het
Kmo	A	G	1: 175,650,659		probably null	Het
Loxhd1	A	G	18: 77,408,787	N29S	probably damaging	Het
Lrp1b	A	T	2: 40,903,448	C2484*	probably null	Het
Lrrc23	T	A	6: 124,770,748	M293L	probably benign	Het
Mphosph6	T	C	8: 117,799,068	D47G	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naglu	G	A	11: 101,076,610	R462H	probably damaging	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nlrc5	T	C	8: 94,521,769	S1711P	probably damaging	Het
Olfr129	T	C	17: 38,055,329	Y79C	possibly damaging	Het
Olfr420	A	T	1: 174,158,859	I29F	probably benign	Het
Olfr97	T	C	17: 37,232,310	E20G	probably benign	Het
Osbpl6	G	A	2: 76,593,387	A857T	probably damaging	Het
Oscp1	C	A	4: 126,088,408	D380E	probably benign	Het
Pdzd7	C	A	19: 45,039,239	R265S	probably benign	Het
Piezo2	A	T	18: 63,113,876		probably null	Het
Pigc	G	A	1: 161,970,464	R5H	probably benign	Het
Pla2g5	C	A	4: 138,804,534	R53L	probably benign	Het
Rbm6	T	C	9: 107,852,706	R248G	probably damaging	Het
Rev1	A	T	1: 38,056,445	L877Q	probably damaging	Het
Rpap3	A	T	15: 97,681,708	N474K	probably benign	Het
Ryr2	T	A	13: 11,827,607	E468V	possibly damaging	Het
Sipa1l2	T	C	8: 125,451,988	N1124S	probably damaging	Het
Slc11a2	G	A	15: 100,409,261	A83V	possibly damaging	Het
Slfn14	A	G	11: 83,281,817		probably null	Het
Sry	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	Y: 2,662,638		probably benign	Het
Suclg1	A	G	6: 73,275,243		probably null	Het
Syne1	A	C	10: 5,342,293	V1325G	probably damaging	Het
Tmprss15	T	C	16: 78,987,650	S706G	probably benign	Het
Tox2	T	C	2: 163,320,376	Y389H	probably damaging	Het
Trappc10	T	C	10: 78,199,075	T946A	probably benign	Het
Ubqln1	C	T	13: 58,177,905	E546K	probably damaging	Het
Zfp106	A	G	2: 120,524,057	V1411A	possibly damaging	Het
Zkscan5	A	T	5: 145,218,703	K395*	probably null	Het

Other mutations in Samd9l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Samd9l	APN	6	3376779	missense	probably damaging	0.96
IGL00550:Samd9l	APN	6	3374594	missense	probably benign	0.00
IGL01100:Samd9l	APN	6	3375863	missense	possibly damaging	0.91
IGL01321:Samd9l	APN	6	3376259	missense	probably benign	0.42
IGL01553:Samd9l	APN	6	3375566	missense	probably damaging	0.99
IGL01575:Samd9l	APN	6	3376734	missense	possibly damaging	0.85
IGL01896:Samd9l	APN	6	3375120	missense	probably benign	0.02
IGL01915:Samd9l	APN	6	3373864	nonsense	probably null
IGL02063:Samd9l	APN	6	3372992	missense	probably damaging	1.00
IGL02066:Samd9l	APN	6	3376575	missense	probably damaging	1.00
IGL02145:Samd9l	APN	6	3374105	missense	probably benign	0.13
IGL02163:Samd9l	APN	6	3374246	missense	possibly damaging	0.90
IGL02256:Samd9l	APN	6	3376197	missense	probably damaging	1.00
IGL02508:Samd9l	APN	6	3374798	missense	probably damaging	1.00
IGL02591:Samd9l	APN	6	3375760	missense	possibly damaging	0.91
IGL02968:Samd9l	APN	6	3376026	missense	probably damaging	1.00
IGL03058:Samd9l	APN	6	3374980	missense	probably damaging	0.99
IGL03068:Samd9l	APN	6	3375348	nonsense	probably null
IGL03160:Samd9l	APN	6	3374894	missense	probably damaging	1.00
IGL03372:Samd9l	APN	6	3375314	missense	probably damaging	1.00
IGL03385:Samd9l	APN	6	3376208	missense	probably damaging	0.99
boston_lager	UTSW	6	3375761	missense	probably benign	0.12
ipa	UTSW	6	3376347	missense	probably damaging	1.00
Paine	UTSW	6	3372716	missense	probably damaging	0.99
samad	UTSW	6	3374032	nonsense	probably null
IGL03054:Samd9l	UTSW	6	3376023	missense	probably damaging	1.00
R0111:Samd9l	UTSW	6	3374946	missense	possibly damaging	0.80
R0112:Samd9l	UTSW	6	3376031	missense	possibly damaging	0.93
R0356:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R0370:Samd9l	UTSW	6	3377264	start gained	probably benign
R0398:Samd9l	UTSW	6	3374502	missense	probably damaging	1.00
R0744:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0833:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0880:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R1110:Samd9l	UTSW	6	3374267	missense	probably benign	0.44
R1155:Samd9l	UTSW	6	3376939	missense	probably benign	0.01
R1268:Samd9l	UTSW	6	3376113	missense	possibly damaging	0.56
R1293:Samd9l	UTSW	6	3373947	missense	possibly damaging	0.93
R1478:Samd9l	UTSW	6	3376369	missense	probably benign	0.06
R1573:Samd9l	UTSW	6	3375426	missense	probably damaging	0.99
R1590:Samd9l	UTSW	6	3375761	missense	probably benign	0.12
R1611:Samd9l	UTSW	6	3373771	missense	probably benign	0.00
R1754:Samd9l	UTSW	6	3373126	missense	probably damaging	0.96
R1759:Samd9l	UTSW	6	3373401	missense	probably damaging	1.00
R1795:Samd9l	UTSW	6	3375264	nonsense	probably null
R1829:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R1935:Samd9l	UTSW	6	3376269	missense	probably benign	0.01
R2154:Samd9l	UTSW	6	3372945	missense	possibly damaging	0.91
R2228:Samd9l	UTSW	6	3376910	missense	probably benign	0.08
R3622:Samd9l	UTSW	6	3374032	nonsense	probably null
R3903:Samd9l	UTSW	6	3376830	nonsense	probably null
R3904:Samd9l	UTSW	6	3376830	nonsense	probably null
R3945:Samd9l	UTSW	6	3377029	missense	possibly damaging	0.71
R4091:Samd9l	UTSW	6	3376887	missense	probably benign	0.22
R4602:Samd9l	UTSW	6	3373935	missense	probably damaging	1.00
R4602:Samd9l	UTSW	6	3373937	frame shift	probably null
R4618:Samd9l	UTSW	6	3376347	missense	probably damaging	1.00
R4747:Samd9l	UTSW	6	3375504	nonsense	probably null
R4762:Samd9l	UTSW	6	3375623	missense	probably benign	0.01
R4814:Samd9l	UTSW	6	3372863	missense	probably damaging	0.98
R4934:Samd9l	UTSW	6	3375621	nonsense	probably null
R5026:Samd9l	UTSW	6	3375284	missense	possibly damaging	0.75
R5048:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R5130:Samd9l	UTSW	6	3374548	missense	possibly damaging	0.69
R5271:Samd9l	UTSW	6	3376156	missense	probably benign	0.02
R5328:Samd9l	UTSW	6	3376739	missense	probably damaging	0.99
R5507:Samd9l	UTSW	6	3373898	missense	possibly damaging	0.78
R5587:Samd9l	UTSW	6	3373291	missense	possibly damaging	0.84
R5846:Samd9l	UTSW	6	3376754	missense	probably benign
R5881:Samd9l	UTSW	6	3372716	missense	possibly damaging	0.70
R5889:Samd9l	UTSW	6	3376460	missense	probably damaging	1.00
R6131:Samd9l	UTSW	6	3377252	missense	probably benign	0.00
R6199:Samd9l	UTSW	6	3376686	missense	probably benign	0.13
R6298:Samd9l	UTSW	6	3375383	missense	probably damaging	1.00
R6331:Samd9l	UTSW	6	3376361	missense	probably damaging	1.00
R6489:Samd9l	UTSW	6	3376896	missense	probably benign
R6601:Samd9l	UTSW	6	3377229	missense	possibly damaging	0.74
R6655:Samd9l	UTSW	6	3377247	missense	probably benign	0.22
R6803:Samd9l	UTSW	6	3375446	missense	probably damaging	0.97
R6864:Samd9l	UTSW	6	3374750	missense	probably benign	0.14
R6905:Samd9l	UTSW	6	3375387	missense	probably damaging	0.99
R6919:Samd9l	UTSW	6	3376313	missense	possibly damaging	0.88
R7060:Samd9l	UTSW	6	3372716	missense	probably damaging	0.99
R7073:Samd9l	UTSW	6	3375856	nonsense	probably null
R7250:Samd9l	UTSW	6	3374201	missense	possibly damaging	0.78
R7307:Samd9l	UTSW	6	3372600	nonsense	probably null
R7351:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R7423:Samd9l	UTSW	6	3374408	missense	probably damaging	1.00
R7610:Samd9l	UTSW	6	3376754	missense	probably benign
R7667:Samd9l	UTSW	6	3375975	missense	possibly damaging	0.87
R7672:Samd9l	UTSW	6	3373646	missense	probably benign	0.16
R7680:Samd9l	UTSW	6	3372569	missense	probably damaging	1.00
R7680:Samd9l	UTSW	6	3376469	missense	probably damaging	1.00
R7814:Samd9l	UTSW	6	3374793	missense	possibly damaging	0.86
R8000:Samd9l	UTSW	6	3373034	missense	probably damaging	1.00
R8098:Samd9l	UTSW	6	3375549	missense	probably damaging	1.00
R8698:Samd9l	UTSW	6	3373843	missense	probably benign	0.06
R8785:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R8795:Samd9l	UTSW	6	3374221	nonsense	probably null
R8806:Samd9l	UTSW	6	3376665	missense	probably damaging	0.99
R8832:Samd9l	UTSW	6	3374990	missense	probably damaging	1.00
R8954:Samd9l	UTSW	6	3374577	missense	probably damaging	0.98
R9023:Samd9l	UTSW	6	3373791	missense	probably damaging	1.00
X0026:Samd9l	UTSW	6	3375560	missense	probably damaging	1.00
X0066:Samd9l	UTSW	6	3374477	missense	probably damaging	1.00
Z1176:Samd9l	UTSW	6	3376770	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGAAATGAGCTGGGCCCTC -3'
(R):5'- CAGCCACGAGGACTTCATTC -3'

Sequencing Primer
(F):5'- TAGCATCCAGGTCCTTCAGAG -3'
(R):5'- ACGAGGACTTCATTCCCGTTC -3'

Posted On

2019-12-03