Incidental Mutation 'R7829:Suclg1'
ID602321
Institutional Source Beutler Lab
Gene Symbol Suclg1
Ensembl Gene ENSMUSG00000052738
Gene Namesuccinate-CoA ligase, GDP-forming, alpha subunit
SynonymsSucla1, 1500000I01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7829 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location73248382-73276911 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 73275243 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064740] [ENSMUST00000203632]
Predicted Effect probably damaging
Transcript: ENSMUST00000064740
AA Change: T290A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000065113
Gene: ENSMUSG00000052738
AA Change: T290A

DomainStartEndE-ValueType
low complexity region 1 29 N/A INTRINSIC
CoA_binding 51 147 6.28e-35 SMART
Pfam:Succ_CoA_lig 193 336 6.7e-11 PFAM
Pfam:Ligase_CoA 199 324 9.3e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203632
SMART Domains Protein: ENSMUSP00000145246
Gene: ENSMUSG00000052738

DomainStartEndE-ValueType
low complexity region 1 28 N/A INTRINSIC
PDB:1EUD|A 37 67 2e-12 PDB
SCOP:d1euca1 41 68 6e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of the heterodimeric enzyme succinate coenzyme A ligase. This enzyme is targeted to the mitochondria and catalyzes the conversion of succinyl CoA and ADP or GDP to succinate and ATP or GTP. Mutations in this gene are the cause of the metabolic disorder fatal infantile lactic acidosis and mitochondrial DNA depletion. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C G 11: 58,879,997 L102V not run Het
Abca12 A T 1: 71,292,421 S1323R probably benign Het
Abcb1a T A 5: 8,698,623 I318N probably benign Het
Adam10 A T 9: 70,766,927 K524* probably null Het
Adamts3 C T 5: 89,861,490 G105R probably damaging Het
Adcy7 T C 8: 88,315,759 I418T probably damaging Het
Alg9 T A 9: 50,788,171 F165L probably damaging Het
Anapc2 G T 2: 25,277,741 R440L probably damaging Het
Arhgef17 A T 7: 100,876,845 H1876Q probably benign Het
Armc2 G A 10: 41,926,860 R606C probably benign Het
Cd163 T C 6: 124,304,779 S14P probably benign Het
Cfap74 T C 4: 155,429,237 V502A Het
Copb2 T C 9: 98,588,094 I891T probably damaging Het
Creb3 T C 4: 43,566,322 L276P probably damaging Het
Crnkl1 T A 2: 145,931,349 M126L probably benign Het
Csrp2 C T 10: 110,935,184 A50V probably damaging Het
Ctsd A G 7: 142,377,142 C284R probably damaging Het
Dll3 G A 7: 28,294,650 A454V probably damaging Het
Dmbx1 C T 4: 115,923,907 probably benign Het
Dnah6 C A 6: 73,127,919 E1896* probably null Het
Dtwd1 A G 2: 126,164,759 T234A probably damaging Het
Fhod3 G A 18: 25,115,890 probably null Het
Gm10549 C A 18: 33,464,410 probably benign Het
Gm7298 T C 6: 121,765,338 I495T probably damaging Het
Grhl3 T C 4: 135,561,221 N51S probably damaging Het
Hsd17b14 A C 7: 45,566,785 S260R probably benign Het
Itgae T A 11: 73,138,792 V1046D probably benign Het
Loxhd1 A G 18: 77,408,787 N29S probably damaging Het
Lrp1b A T 2: 40,903,448 C2484* probably null Het
Lrrc23 T A 6: 124,770,748 M293L probably benign Het
Mphosph6 T C 8: 117,799,068 D47G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naglu G A 11: 101,076,610 R462H probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrc5 T C 8: 94,521,769 S1711P probably damaging Het
Olfr129 T C 17: 38,055,329 Y79C possibly damaging Het
Olfr420 A T 1: 174,158,859 I29F probably benign Het
Olfr97 T C 17: 37,232,310 E20G probably benign Het
Osbpl6 G A 2: 76,593,387 A857T probably damaging Het
Oscp1 C A 4: 126,088,408 D380E probably benign Het
Pdzd7 C A 19: 45,039,239 R265S probably benign Het
Piezo2 A T 18: 63,113,876 probably null Het
Pigc G A 1: 161,970,464 R5H probably benign Het
Pla2g5 C A 4: 138,804,534 R53L probably benign Het
Rbm6 T C 9: 107,852,706 R248G probably damaging Het
Rev1 A T 1: 38,056,445 L877Q probably damaging Het
Rpap3 A T 15: 97,681,708 N474K probably benign Het
Ryr2 T A 13: 11,827,607 E468V possibly damaging Het
Samd9l A C 6: 3,374,749 D837E probably benign Het
Sipa1l2 T C 8: 125,451,988 N1124S probably damaging Het
Slc11a2 G A 15: 100,409,261 A83V possibly damaging Het
Slfn14 A G 11: 83,281,817 probably null Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Syne1 A C 10: 5,342,293 V1325G probably damaging Het
Tmprss15 T C 16: 78,987,650 S706G probably benign Het
Tox2 T C 2: 163,320,376 Y389H probably damaging Het
Trappc10 T C 10: 78,199,075 T946A probably benign Het
Ubqln1 C T 13: 58,177,905 E546K probably damaging Het
Zfp106 A G 2: 120,524,057 V1411A possibly damaging Het
Zkscan5 A T 5: 145,218,703 K395* probably null Het
Other mutations in Suclg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01864:Suclg1 APN 6 73264297 intron probably benign
IGL02657:Suclg1 APN 6 73260521 missense probably damaging 1.00
IGL03250:Suclg1 APN 6 73270992 missense probably benign 0.04
IGL03306:Suclg1 APN 6 73270992 missense probably benign 0.04
R0012:Suclg1 UTSW 6 73270997 missense possibly damaging 0.66
R0012:Suclg1 UTSW 6 73270997 missense possibly damaging 0.66
R0038:Suclg1 UTSW 6 73260503 missense probably benign 0.26
R0038:Suclg1 UTSW 6 73260503 missense probably benign 0.26
R0379:Suclg1 UTSW 6 73256228 missense possibly damaging 0.89
R0969:Suclg1 UTSW 6 73271116 missense probably benign 0.33
R1123:Suclg1 UTSW 6 73256227 missense probably benign 0.02
R2089:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R2091:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R2091:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R5083:Suclg1 UTSW 6 73263980 missense probably benign
R6176:Suclg1 UTSW 6 73275343 missense probably damaging 1.00
R6313:Suclg1 UTSW 6 73256209 missense probably damaging 0.97
R6338:Suclg1 UTSW 6 73264246 missense probably damaging 1.00
R7231:Suclg1 UTSW 6 73263971 missense probably benign 0.00
R7246:Suclg1 UTSW 6 73276713 missense unknown
R7250:Suclg1 UTSW 6 73271091 missense probably benign 0.00
R7524:Suclg1 UTSW 6 73263841 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGCTTGCTCAGTGACTTC -3'
(R):5'- GACACAGCTATCGTGTGCTC -3'

Sequencing Primer
(F):5'- AGCTCTGAGTCTCCTGAAGG -3'
(R):5'- CGTGTGCTCACCTTATAAATGG -3'
Posted On2019-12-03