Incidental Mutation 'R7829:Cd163'
ID602323
Institutional Source Beutler Lab
Gene Symbol Cd163
Ensembl Gene ENSMUSG00000008845
Gene NameCD163 antigen
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7829 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location124304656-124330527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124304779 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 14 (S14P)
Ref Sequence ENSEMBL: ENSMUSP00000108160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032234] [ENSMUST00000112541]
Predicted Effect probably benign
Transcript: ENSMUST00000032234
AA Change: S14P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000032234
Gene: ENSMUSG00000008845
AA Change: S14P

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SR 50 150 1.1e-52 SMART
SR 157 258 1.4e-55 SMART
SR 265 365 7.3e-60 SMART
SR 372 472 1.2e-35 SMART
SR 477 577 2.3e-41 SMART
SR 582 682 9.8e-39 SMART
SR 719 819 1.1e-60 SMART
SR 824 927 4e-24 SMART
SR 930 1030 2.3e-55 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112541
AA Change: S14P

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108160
Gene: ENSMUSG00000008845
AA Change: S14P

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
SR 50 150 2.26e-50 SMART
SR 157 258 3.11e-53 SMART
SR 265 365 1.54e-57 SMART
SR 372 472 2.64e-33 SMART
SR 477 577 5.03e-39 SMART
SR 582 682 2.09e-36 SMART
SR 719 819 2.38e-58 SMART
SR 824 927 8.93e-22 SMART
SR 930 1030 5.06e-53 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: After hindlimb ischemia, mice homozygous for a knock-out allele exhibit increased muscle satellite cell proliferation, and enhanced skeletal muscle regeneration not limited to the site of injury. Knock-out mice also exhibit increased eosinophilic airway inflammation in house dust mite-challenged. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C G 11: 58,879,997 L102V not run Het
Abca12 A T 1: 71,292,421 S1323R probably benign Het
Abcb1a T A 5: 8,698,623 I318N probably benign Het
Adam10 A T 9: 70,766,927 K524* probably null Het
Adamts3 C T 5: 89,861,490 G105R probably damaging Het
Adcy7 T C 8: 88,315,759 I418T probably damaging Het
Alg9 T A 9: 50,788,171 F165L probably damaging Het
Anapc2 G T 2: 25,277,741 R440L probably damaging Het
Arhgef17 A T 7: 100,876,845 H1876Q probably benign Het
Armc2 G A 10: 41,926,860 R606C probably benign Het
Cfap74 T C 4: 155,429,237 V502A Het
Copb2 T C 9: 98,588,094 I891T probably damaging Het
Creb3 T C 4: 43,566,322 L276P probably damaging Het
Crnkl1 T A 2: 145,931,349 M126L probably benign Het
Csrp2 C T 10: 110,935,184 A50V probably damaging Het
Ctsd A G 7: 142,377,142 C284R probably damaging Het
Dll3 G A 7: 28,294,650 A454V probably damaging Het
Dmbx1 C T 4: 115,923,907 probably benign Het
Dnah6 C A 6: 73,127,919 E1896* probably null Het
Dtwd1 A G 2: 126,164,759 T234A probably damaging Het
Fhod3 G A 18: 25,115,890 probably null Het
Gm10549 C A 18: 33,464,410 probably benign Het
Gm7298 T C 6: 121,765,338 I495T probably damaging Het
Grhl3 T C 4: 135,561,221 N51S probably damaging Het
Gtpbp4 A T 13: 8,985,330 probably null Het
Hsd17b14 A C 7: 45,566,785 S260R probably benign Het
Insig2 A T 1: 121,307,329 probably null Het
Itgae T A 11: 73,138,792 V1046D probably benign Het
Kif1b A T 4: 149,220,990 probably null Het
Kmo A G 1: 175,650,659 probably null Het
Loxhd1 A G 18: 77,408,787 N29S probably damaging Het
Lrp1b A T 2: 40,903,448 C2484* probably null Het
Lrrc23 T A 6: 124,770,748 M293L probably benign Het
Mphosph6 T C 8: 117,799,068 D47G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naglu G A 11: 101,076,610 R462H probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrc5 T C 8: 94,521,769 S1711P probably damaging Het
Olfr129 T C 17: 38,055,329 Y79C possibly damaging Het
Olfr420 A T 1: 174,158,859 I29F probably benign Het
Olfr97 T C 17: 37,232,310 E20G probably benign Het
Osbpl6 G A 2: 76,593,387 A857T probably damaging Het
Oscp1 C A 4: 126,088,408 D380E probably benign Het
Pdzd7 C A 19: 45,039,239 R265S probably benign Het
Piezo2 A T 18: 63,113,876 probably null Het
Pigc G A 1: 161,970,464 R5H probably benign Het
Pla2g5 C A 4: 138,804,534 R53L probably benign Het
Rbm6 T C 9: 107,852,706 R248G probably damaging Het
Rev1 A T 1: 38,056,445 L877Q probably damaging Het
Rpap3 A T 15: 97,681,708 N474K probably benign Het
Ryr2 T A 13: 11,827,607 E468V possibly damaging Het
Samd9l A C 6: 3,374,749 D837E probably benign Het
Sipa1l2 T C 8: 125,451,988 N1124S probably damaging Het
Slc11a2 G A 15: 100,409,261 A83V possibly damaging Het
Slfn14 A G 11: 83,281,817 probably null Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Suclg1 A G 6: 73,275,243 probably null Het
Syne1 A C 10: 5,342,293 V1325G probably damaging Het
Tmprss15 T C 16: 78,987,650 S706G probably benign Het
Tox2 T C 2: 163,320,376 Y389H probably damaging Het
Trappc10 T C 10: 78,199,075 T946A probably benign Het
Ubqln1 C T 13: 58,177,905 E546K probably damaging Het
Zfp106 A G 2: 120,524,057 V1411A possibly damaging Het
Zkscan5 A T 5: 145,218,703 K395* probably null Het
Other mutations in Cd163
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Cd163 APN 6 124329101 splice site probably benign
IGL00755:Cd163 APN 6 124318657 missense possibly damaging 0.70
IGL01690:Cd163 APN 6 124307318 missense possibly damaging 0.89
IGL02101:Cd163 APN 6 124307287 nonsense probably null
IGL02733:Cd163 APN 6 124325341 missense probably damaging 1.00
IGL02801:Cd163 APN 6 124320529 missense probably benign 0.00
IGL02897:Cd163 APN 6 124325527 missense probably damaging 1.00
IGL03074:Cd163 APN 6 124317986 missense probably benign 0.00
IGL03283:Cd163 APN 6 124309199 missense possibly damaging 0.49
compass UTSW 6 124329086 makesense probably null
hottish UTSW 6 124309208 missense probably damaging 1.00
protractor UTSW 6 124311566 missense probably damaging 1.00
t-square UTSW 6 124325288 missense probably damaging 0.97
R0494:Cd163 UTSW 6 124311449 missense probably damaging 1.00
R0554:Cd163 UTSW 6 124312660 missense probably benign 0.03
R0622:Cd163 UTSW 6 124317352 missense probably damaging 1.00
R1004:Cd163 UTSW 6 124325347 missense probably damaging 1.00
R1061:Cd163 UTSW 6 124309169 missense probably benign 0.00
R1132:Cd163 UTSW 6 124309096 nonsense probably null
R1195:Cd163 UTSW 6 124325250 splice site probably benign
R1195:Cd163 UTSW 6 124325250 splice site probably benign
R1436:Cd163 UTSW 6 124327931 missense possibly damaging 0.47
R1463:Cd163 UTSW 6 124311447 missense probably damaging 1.00
R1532:Cd163 UTSW 6 124312730 missense possibly damaging 0.91
R1541:Cd163 UTSW 6 124327961 missense probably benign
R1654:Cd163 UTSW 6 124317581 missense probably damaging 1.00
R1717:Cd163 UTSW 6 124329588 utr 3 prime probably benign
R1744:Cd163 UTSW 6 124307028 missense possibly damaging 0.94
R2014:Cd163 UTSW 6 124325498 missense probably damaging 0.99
R2035:Cd163 UTSW 6 124320629 missense probably damaging 0.97
R2095:Cd163 UTSW 6 124317822 missense probably damaging 1.00
R2124:Cd163 UTSW 6 124318856 missense probably damaging 1.00
R2146:Cd163 UTSW 6 124309208 missense probably damaging 1.00
R2353:Cd163 UTSW 6 124319156 nonsense probably null
R3854:Cd163 UTSW 6 124311566 missense probably damaging 1.00
R4425:Cd163 UTSW 6 124327903 missense possibly damaging 0.94
R4631:Cd163 UTSW 6 124329086 makesense probably null
R4647:Cd163 UTSW 6 124320621 missense probably damaging 1.00
R4713:Cd163 UTSW 6 124317618 critical splice donor site probably null
R4803:Cd163 UTSW 6 124312430 missense probably damaging 0.99
R4996:Cd163 UTSW 6 124319147 missense probably benign 0.00
R5022:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5023:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5032:Cd163 UTSW 6 124311669 missense probably damaging 1.00
R5057:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5121:Cd163 UTSW 6 124317989 missense probably damaging 1.00
R5436:Cd163 UTSW 6 124327964 missense probably benign
R5453:Cd163 UTSW 6 124312541 missense probably damaging 1.00
R5723:Cd163 UTSW 6 124319063 missense probably benign 0.00
R5929:Cd163 UTSW 6 124326609 critical splice donor site probably null
R5943:Cd163 UTSW 6 124329602 makesense probably null
R5964:Cd163 UTSW 6 124326572 missense probably benign 0.01
R5966:Cd163 UTSW 6 124320636 nonsense probably null
R6279:Cd163 UTSW 6 124317991 nonsense probably null
R6300:Cd163 UTSW 6 124317991 nonsense probably null
R6499:Cd163 UTSW 6 124304744 missense probably benign 0.00
R6602:Cd163 UTSW 6 124311635 missense probably damaging 1.00
R6708:Cd163 UTSW 6 124309208 missense probably damaging 1.00
R6767:Cd163 UTSW 6 124304779 missense possibly damaging 0.56
R6979:Cd163 UTSW 6 124317986 missense probably benign 0.00
R6993:Cd163 UTSW 6 124317714 missense probably damaging 1.00
R7345:Cd163 UTSW 6 124318938 missense possibly damaging 0.52
R7382:Cd163 UTSW 6 124311312 splice site probably null
R7552:Cd163 UTSW 6 124307228 missense probably benign 0.08
R8354:Cd163 UTSW 6 124328965 missense probably benign 0.43
R8454:Cd163 UTSW 6 124328965 missense probably benign 0.43
Z1177:Cd163 UTSW 6 124317385 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AGGACTCTCCCTTTAAGATTGGC -3'
(R):5'- CACACCCAGGACAGTTTTGC -3'

Sequencing Primer
(F):5'- AAGATTGGCTCCTCCCTCC -3'
(R):5'- CCAGGACAGTTTTGCTTACTTCAGG -3'
Posted On2019-12-03