Incidental Mutation 'R7829:Lrrc23'
ID 602324
Institutional Source Beutler Lab
Gene Symbol Lrrc23
Ensembl Gene ENSMUSG00000030125
Gene Name leucine rich repeat containing 23
Synonyms 4921537K05Rik, Lrpb7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7829 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 124769863-124779727 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124770748 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 293 (M293L)
Ref Sequence ENSEMBL: ENSMUSP00000108094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004378] [ENSMUST00000032218] [ENSMUST00000112475] [ENSMUST00000112476] [ENSMUST00000127274] [ENSMUST00000135626] [ENSMUST00000138770] [ENSMUST00000149652] [ENSMUST00000151214] [ENSMUST00000156033] [ENSMUST00000204896]
AlphaFold O35125
Predicted Effect probably benign
Transcript: ENSMUST00000004378
SMART Domains Protein: ENSMUSP00000004378
Gene: ENSMUSG00000004267

DomainStartEndE-ValueType
Enolase_N 3 134 2.62e-93 SMART
Enolase_C 142 431 2.62e-207 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032218
AA Change: M293L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032218
Gene: ENSMUSG00000030125
AA Change: M293L

DomainStartEndE-ValueType
coiled coil region 12 40 N/A INTRINSIC
Pfam:LRR_1 89 109 1.2e-2 PFAM
LRR 196 217 1.33e2 SMART
LRR 218 239 4.97e0 SMART
LRR 241 263 3.27e1 SMART
low complexity region 305 314 N/A INTRINSIC
low complexity region 323 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112475
AA Change: M293L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108094
Gene: ENSMUSG00000030125
AA Change: M293L

DomainStartEndE-ValueType
coiled coil region 12 40 N/A INTRINSIC
internal_repeat_1 90 182 7.1e-5 PROSPERO
LRR 196 217 1.33e2 SMART
LRR 218 239 4.97e0 SMART
LRR 241 263 3.27e1 SMART
low complexity region 305 314 N/A INTRINSIC
low complexity region 323 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112476
SMART Domains Protein: ENSMUSP00000108095
Gene: ENSMUSG00000004267

DomainStartEndE-ValueType
Enolase_N 3 118 2.39e-55 SMART
Enolase_C 71 312 9.08e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127274
Predicted Effect probably benign
Transcript: ENSMUST00000135626
SMART Domains Protein: ENSMUSP00000114500
Gene: ENSMUSG00000004267

DomainStartEndE-ValueType
Enolase_N 3 118 2.39e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138770
Predicted Effect probably benign
Transcript: ENSMUST00000149652
SMART Domains Protein: ENSMUSP00000119112
Gene: ENSMUSG00000004267

DomainStartEndE-ValueType
Enolase_N 3 134 2.62e-93 SMART
Pfam:Enolase_C 142 162 4.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151214
Predicted Effect probably benign
Transcript: ENSMUST00000156033
SMART Domains Protein: ENSMUSP00000144698
Gene: ENSMUSG00000004267

DomainStartEndE-ValueType
Enolase_N 3 58 5.2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204896
SMART Domains Protein: ENSMUSP00000144861
Gene: ENSMUSG00000004267

DomainStartEndE-ValueType
Enolase_N 3 91 8e-52 SMART
Enolase_C 99 388 1.3e-211 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C G 11: 58,879,997 L102V not run Het
Abca12 A T 1: 71,292,421 S1323R probably benign Het
Abcb1a T A 5: 8,698,623 I318N probably benign Het
Adam10 A T 9: 70,766,927 K524* probably null Het
Adamts3 C T 5: 89,861,490 G105R probably damaging Het
Adcy7 T C 8: 88,315,759 I418T probably damaging Het
Alg9 T A 9: 50,788,171 F165L probably damaging Het
Anapc2 G T 2: 25,277,741 R440L probably damaging Het
Arhgef17 A T 7: 100,876,845 H1876Q probably benign Het
Armc2 G A 10: 41,926,860 R606C probably benign Het
Cd163 T C 6: 124,304,779 S14P probably benign Het
Cfap74 T C 4: 155,429,237 V502A Het
Copb2 T C 9: 98,588,094 I891T probably damaging Het
Creb3 T C 4: 43,566,322 L276P probably damaging Het
Crnkl1 T A 2: 145,931,349 M126L probably benign Het
Csrp2 C T 10: 110,935,184 A50V probably damaging Het
Ctsd A G 7: 142,377,142 C284R probably damaging Het
Dll3 G A 7: 28,294,650 A454V probably damaging Het
Dmbx1 C T 4: 115,923,907 probably benign Het
Dnah6 C A 6: 73,127,919 E1896* probably null Het
Dtwd1 A G 2: 126,164,759 T234A probably damaging Het
Fhod3 G A 18: 25,115,890 probably null Het
Gm10549 C A 18: 33,464,410 probably benign Het
Gm7298 T C 6: 121,765,338 I495T probably damaging Het
Grhl3 T C 4: 135,561,221 N51S probably damaging Het
Gtpbp4 A T 13: 8,985,330 probably null Het
Hsd17b14 A C 7: 45,566,785 S260R probably benign Het
Insig2 A T 1: 121,307,329 probably null Het
Itgae T A 11: 73,138,792 V1046D probably benign Het
Kif1b A T 4: 149,220,990 probably null Het
Kmo A G 1: 175,650,659 probably null Het
Loxhd1 A G 18: 77,408,787 N29S probably damaging Het
Lrp1b A T 2: 40,903,448 C2484* probably null Het
Mphosph6 T C 8: 117,799,068 D47G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naglu G A 11: 101,076,610 R462H probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrc5 T C 8: 94,521,769 S1711P probably damaging Het
Olfr129 T C 17: 38,055,329 Y79C possibly damaging Het
Olfr420 A T 1: 174,158,859 I29F probably benign Het
Olfr97 T C 17: 37,232,310 E20G probably benign Het
Osbpl6 G A 2: 76,593,387 A857T probably damaging Het
Oscp1 C A 4: 126,088,408 D380E probably benign Het
Pdzd7 C A 19: 45,039,239 R265S probably benign Het
Piezo2 A T 18: 63,113,876 probably null Het
Pigc G A 1: 161,970,464 R5H probably benign Het
Pla2g5 C A 4: 138,804,534 R53L probably benign Het
Rbm6 T C 9: 107,852,706 R248G probably damaging Het
Rev1 A T 1: 38,056,445 L877Q probably damaging Het
Rpap3 A T 15: 97,681,708 N474K probably benign Het
Ryr2 T A 13: 11,827,607 E468V possibly damaging Het
Samd9l A C 6: 3,374,749 D837E probably benign Het
Sipa1l2 T C 8: 125,451,988 N1124S probably damaging Het
Slc11a2 G A 15: 100,409,261 A83V possibly damaging Het
Slfn14 A G 11: 83,281,817 probably null Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Suclg1 A G 6: 73,275,243 probably null Het
Syne1 A C 10: 5,342,293 V1325G probably damaging Het
Tmprss15 T C 16: 78,987,650 S706G probably benign Het
Tox2 T C 2: 163,320,376 Y389H probably damaging Het
Trappc10 T C 10: 78,199,075 T946A probably benign Het
Ubqln1 C T 13: 58,177,905 E546K probably damaging Het
Zfp106 A G 2: 120,524,057 V1411A possibly damaging Het
Zkscan5 A T 5: 145,218,703 K395* probably null Het
Other mutations in Lrrc23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Lrrc23 APN 6 124778926 missense probably damaging 1.00
IGL01123:Lrrc23 APN 6 124778819 missense probably benign 0.04
IGL02429:Lrrc23 APN 6 124778167 missense probably damaging 0.99
IGL02892:Lrrc23 APN 6 124774436 missense probably benign 0.03
R0440:Lrrc23 UTSW 6 124770704 missense probably benign 0.00
R0637:Lrrc23 UTSW 6 124778358 unclassified probably benign
R1055:Lrrc23 UTSW 6 124778151 missense probably damaging 1.00
R1125:Lrrc23 UTSW 6 124776182 missense probably benign 0.06
R1531:Lrrc23 UTSW 6 124776114 missense possibly damaging 0.91
R4156:Lrrc23 UTSW 6 124770841 nonsense probably null
R4838:Lrrc23 UTSW 6 124778189 missense probably benign 0.16
R5296:Lrrc23 UTSW 6 124774482 missense probably damaging 0.98
R7211:Lrrc23 UTSW 6 124778189 missense probably benign 0.16
R7426:Lrrc23 UTSW 6 124779125 missense unknown
R7488:Lrrc23 UTSW 6 124779112 missense unknown
R7583:Lrrc23 UTSW 6 124779578 start gained probably benign
R8289:Lrrc23 UTSW 6 124778304 missense probably damaging 1.00
R8726:Lrrc23 UTSW 6 124776080 missense probably benign 0.03
R9196:Lrrc23 UTSW 6 124778226 missense possibly damaging 0.77
R9384:Lrrc23 UTSW 6 124778226 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TTTACTGTCCCTGCAGGCTG -3'
(R):5'- ATCATTGCTTTCGGGGAGC -3'

Sequencing Primer
(F):5'- CTGGAAGAGCCACTAAACTGGTG -3'
(R):5'- GAGTTGCTTCCTCTTACAAAGGCAG -3'
Posted On 2019-12-03