Incidental Mutation 'R7829:Alg9'
ID602333
Institutional Source Beutler Lab
Gene Symbol Alg9
Ensembl Gene ENSMUSG00000032059
Gene Nameasparagine-linked glycosylation 9 (alpha 1,2 mannosyltransferase)
SynonymsB430313H07Rik, 8230402H15Rik, Dibd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7829 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location50775019-50843542 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50788171 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 165 (F165L)
Ref Sequence ENSEMBL: ENSMUSP00000034561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034561] [ENSMUST00000159576] [ENSMUST00000162073]
Predicted Effect probably damaging
Transcript: ENSMUST00000034561
AA Change: F165L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034561
Gene: ENSMUSG00000032059
AA Change: F165L

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 482 3.5e-127 PFAM
low complexity region 598 611 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159576
AA Change: F199L

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123711
Gene: ENSMUSG00000032059
AA Change: F199L

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 228 1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162073
AA Change: W142R

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000125425
Gene: ENSMUSG00000032059
AA Change: W142R

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 167 7.5e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha-1,2-mannosyltransferase enzyme that functions in lipid-linked oligosaccharide assembly. Mutations in this gene result in congenital disorder of glycosylation type Il. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C G 11: 58,879,997 L102V not run Het
Abca12 A T 1: 71,292,421 S1323R probably benign Het
Abcb1a T A 5: 8,698,623 I318N probably benign Het
Adam10 A T 9: 70,766,927 K524* probably null Het
Adamts3 C T 5: 89,861,490 G105R probably damaging Het
Adcy7 T C 8: 88,315,759 I418T probably damaging Het
Anapc2 G T 2: 25,277,741 R440L probably damaging Het
Arhgef17 A T 7: 100,876,845 H1876Q probably benign Het
Armc2 G A 10: 41,926,860 R606C probably benign Het
Cd163 T C 6: 124,304,779 S14P probably benign Het
Cfap74 T C 4: 155,429,237 V502A Het
Copb2 T C 9: 98,588,094 I891T probably damaging Het
Creb3 T C 4: 43,566,322 L276P probably damaging Het
Crnkl1 T A 2: 145,931,349 M126L probably benign Het
Csrp2 C T 10: 110,935,184 A50V probably damaging Het
Ctsd A G 7: 142,377,142 C284R probably damaging Het
Dll3 G A 7: 28,294,650 A454V probably damaging Het
Dmbx1 C T 4: 115,923,907 probably benign Het
Dnah6 C A 6: 73,127,919 E1896* probably null Het
Dtwd1 A G 2: 126,164,759 T234A probably damaging Het
Fhod3 G A 18: 25,115,890 probably null Het
Gm10549 C A 18: 33,464,410 probably benign Het
Gm7298 T C 6: 121,765,338 I495T probably damaging Het
Grhl3 T C 4: 135,561,221 N51S probably damaging Het
Gtpbp4 A T 13: 8,985,330 probably null Het
Hsd17b14 A C 7: 45,566,785 S260R probably benign Het
Insig2 A T 1: 121,307,329 probably null Het
Itgae T A 11: 73,138,792 V1046D probably benign Het
Kif1b A T 4: 149,220,990 probably null Het
Kmo A G 1: 175,650,659 probably null Het
Loxhd1 A G 18: 77,408,787 N29S probably damaging Het
Lrp1b A T 2: 40,903,448 C2484* probably null Het
Lrrc23 T A 6: 124,770,748 M293L probably benign Het
Mphosph6 T C 8: 117,799,068 D47G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naglu G A 11: 101,076,610 R462H probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrc5 T C 8: 94,521,769 S1711P probably damaging Het
Olfr129 T C 17: 38,055,329 Y79C possibly damaging Het
Olfr420 A T 1: 174,158,859 I29F probably benign Het
Olfr97 T C 17: 37,232,310 E20G probably benign Het
Osbpl6 G A 2: 76,593,387 A857T probably damaging Het
Oscp1 C A 4: 126,088,408 D380E probably benign Het
Pdzd7 C A 19: 45,039,239 R265S probably benign Het
Piezo2 A T 18: 63,113,876 probably null Het
Pigc G A 1: 161,970,464 R5H probably benign Het
Pla2g5 C A 4: 138,804,534 R53L probably benign Het
Rbm6 T C 9: 107,852,706 R248G probably damaging Het
Rev1 A T 1: 38,056,445 L877Q probably damaging Het
Rpap3 A T 15: 97,681,708 N474K probably benign Het
Ryr2 T A 13: 11,827,607 E468V possibly damaging Het
Samd9l A C 6: 3,374,749 D837E probably benign Het
Sipa1l2 T C 8: 125,451,988 N1124S probably damaging Het
Slc11a2 G A 15: 100,409,261 A83V possibly damaging Het
Slfn14 A G 11: 83,281,817 probably null Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Suclg1 A G 6: 73,275,243 probably null Het
Syne1 A C 10: 5,342,293 V1325G probably damaging Het
Tmprss15 T C 16: 78,987,650 S706G probably benign Het
Tox2 T C 2: 163,320,376 Y389H probably damaging Het
Trappc10 T C 10: 78,199,075 T946A probably benign Het
Ubqln1 C T 13: 58,177,905 E546K probably damaging Het
Zfp106 A G 2: 120,524,057 V1411A possibly damaging Het
Zkscan5 A T 5: 145,218,703 K395* probably null Het
Other mutations in Alg9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Alg9 APN 9 50775377 splice site probably null
IGL02792:Alg9 APN 9 50842748 missense possibly damaging 0.90
gum_drop UTSW 9 50805354 missense possibly damaging 0.90
FR4976:Alg9 UTSW 9 50775431 unclassified probably benign
R1183:Alg9 UTSW 9 50789533 missense possibly damaging 0.82
R1270:Alg9 UTSW 9 50787572 intron probably benign
R1575:Alg9 UTSW 9 50775502 missense possibly damaging 0.65
R1773:Alg9 UTSW 9 50779096 missense probably benign 0.30
R1837:Alg9 UTSW 9 50806315 missense probably damaging 1.00
R2011:Alg9 UTSW 9 50788200 missense probably damaging 1.00
R4324:Alg9 UTSW 9 50805343 missense probably damaging 1.00
R4514:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4544:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4546:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4996:Alg9 UTSW 9 50808705 missense probably damaging 1.00
R5007:Alg9 UTSW 9 50788224 missense probably damaging 1.00
R5053:Alg9 UTSW 9 50788172 missense probably damaging 1.00
R5308:Alg9 UTSW 9 50822711 missense possibly damaging 0.95
R6803:Alg9 UTSW 9 50789560 missense probably benign 0.37
R6994:Alg9 UTSW 9 50792122 nonsense probably null
R6998:Alg9 UTSW 9 50789621 missense possibly damaging 0.95
R7298:Alg9 UTSW 9 50779061 missense probably damaging 0.97
R7480:Alg9 UTSW 9 50822628 missense probably benign 0.06
R7561:Alg9 UTSW 9 50842774 missense possibly damaging 0.95
R7578:Alg9 UTSW 9 50789535 missense probably benign
R7721:Alg9 UTSW 9 50776642 missense probably damaging 0.99
R7847:Alg9 UTSW 9 50789605 missense possibly damaging 0.62
R7878:Alg9 UTSW 9 50842783 missense probably benign 0.00
R8113:Alg9 UTSW 9 50808780 nonsense probably null
R8257:Alg9 UTSW 9 50779087 missense possibly damaging 0.62
RF003:Alg9 UTSW 9 50775427 unclassified probably benign
RF006:Alg9 UTSW 9 50775417 unclassified probably benign
RF058:Alg9 UTSW 9 50775427 unclassified probably benign
Z1177:Alg9 UTSW 9 50788173 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATTTCCTCTTAAGTAAGGAGC -3'
(R):5'- TGAAGCAGACAGAGACCTGC -3'

Sequencing Primer
(F):5'- CCTCTTAAGTAAGGAGCTTTTTCG -3'
(R):5'- CTGCCCAGGATTCGGGTTATAAAAG -3'
Posted On2019-12-03