Mutagenetix > Incidental Mutations

Incidental Mutation 'R7829:Loxhd1'

602355

Institutional Source

Beutler Lab

Gene Symbol

Loxhd1

Ensembl Gene

ENSMUSG00000032818

Gene Name

lipoxygenase homology domains 1

Synonyms

sba, 1700096C21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R7829 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77281958-77442341 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 77408787 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 29 (N29S)

Ref Sequence

ENSEMBL: ENSMUSP00000116287 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096547] [ENSMUST00000123166] [ENSMUST00000123410] [ENSMUST00000148341]

Predicted Effect

probably damaging
Transcript: ENSMUST00000096547
AA Change: N1581S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: N1581S

Domain	Start	End	E-Value	Type
LH2	43	158	5.64e-5	SMART
LH2	172	290	1.64e-9	SMART
LH2	296	409	1.1e-4	SMART
LH2	425	539	4.02e-4	SMART
LH2	553	675	3.79e-6	SMART
LH2	684	800	5.92e-6	SMART
LH2	814	936	6.91e-8	SMART
low complexity region	945	954	N/A	INTRINSIC
LH2	970	1086	4.81e-7	SMART
LH2	1101	1228	5.73e-3	SMART
LH2	1255	1375	8.82e-5	SMART
Pfam:PLAT	1424	1540	5.4e-10	PFAM
LH2	1553	1666	6.41e-3	SMART
LH2	1680	1799	6.76e-6	SMART
Pfam:PLAT	1813	1929	3.8e-9	PFAM
LH2	1949	2067	7.23e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000123166
AA Change: N29S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000116287
Gene: ENSMUSG00000032818
AA Change: N29S

Domain	Start	End	E-Value	Type
LH2	1	114	6.41e-3	SMART
LH2	128	247	6.76e-6	SMART
Pfam:PLAT	261	379	1.3e-8	PFAM
LH2	397	515	7.23e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123410
AA Change: N715S

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000120991
Gene: ENSMUSG00000032818
AA Change: N715S

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	67	4.4e-15	PFAM
low complexity region	79	88	N/A	INTRINSIC
LH2	104	220	4.81e-7	SMART
LH2	235	362	5.73e-3	SMART
LH2	389	509	8.82e-5	SMART
Pfam:PLAT	558	674	9.9e-12	PFAM
LH2	687	800	6.41e-3	SMART
LH2	814	933	6.76e-6	SMART
Pfam:PLAT	947	1065	8.8e-9	PFAM
Pfam:PLAT	1085	1174	4.2e-11	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000148341
AA Change: N1410S

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000114988
Gene: ENSMUSG00000032818
AA Change: N1410S

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	91	1.7e-11	PFAM
LH2	106	220	4.02e-4	SMART
LH2	234	356	3.79e-6	SMART
LH2	365	481	5.92e-6	SMART
LH2	495	610	7.67e-3	SMART
LH2	707	827	1.47e-11	SMART
low complexity region	836	845	N/A	INTRINSIC
LH2	861	977	4.81e-7	SMART
LH2	992	1119	5.73e-3	SMART
LH2	1146	1266	8.82e-5	SMART
Pfam:PLAT	1384	1469	8.9e-14	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

97% (61/63)

MGI Phenotype

PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	C	G	11: 58,879,997	L102V	not run	Het
Abca12	A	T	1: 71,292,421	S1323R	probably benign	Het
Abcb1a	T	A	5: 8,698,623	I318N	probably benign	Het
Adam10	A	T	9: 70,766,927	K524*	probably null	Het
Adamts3	C	T	5: 89,861,490	G105R	probably damaging	Het
Adcy7	T	C	8: 88,315,759	I418T	probably damaging	Het
Alg9	T	A	9: 50,788,171	F165L	probably damaging	Het
Anapc2	G	T	2: 25,277,741	R440L	probably damaging	Het
Arhgef17	A	T	7: 100,876,845	H1876Q	probably benign	Het
Armc2	G	A	10: 41,926,860	R606C	probably benign	Het
Cd163	T	C	6: 124,304,779	S14P	probably benign	Het
Cfap74	T	C	4: 155,429,237	V502A		Het
Copb2	T	C	9: 98,588,094	I891T	probably damaging	Het
Creb3	T	C	4: 43,566,322	L276P	probably damaging	Het
Crnkl1	T	A	2: 145,931,349	M126L	probably benign	Het
Csrp2	C	T	10: 110,935,184	A50V	probably damaging	Het
Ctsd	A	G	7: 142,377,142	C284R	probably damaging	Het
Dll3	G	A	7: 28,294,650	A454V	probably damaging	Het
Dmbx1	C	T	4: 115,923,907		probably benign	Het
Dnah6	C	A	6: 73,127,919	E1896*	probably null	Het
Dtwd1	A	G	2: 126,164,759	T234A	probably damaging	Het
Fhod3	G	A	18: 25,115,890		probably null	Het
Gm10549	C	A	18: 33,464,410		probably benign	Het
Gm7298	T	C	6: 121,765,338	I495T	probably damaging	Het
Grhl3	T	C	4: 135,561,221	N51S	probably damaging	Het
Gtpbp4	A	T	13: 8,985,330		probably null	Het
Hsd17b14	A	C	7: 45,566,785	S260R	probably benign	Het
Insig2	A	T	1: 121,307,329		probably null	Het
Itgae	T	A	11: 73,138,792	V1046D	probably benign	Het
Kif1b	A	T	4: 149,220,990		probably null	Het
Kmo	A	G	1: 175,650,659		probably null	Het
Lrp1b	A	T	2: 40,903,448	C2484*	probably null	Het
Lrrc23	T	A	6: 124,770,748	M293L	probably benign	Het
Mphosph6	T	C	8: 117,799,068	D47G	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naglu	G	A	11: 101,076,610	R462H	probably damaging	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nlrc5	T	C	8: 94,521,769	S1711P	probably damaging	Het
Olfr129	T	C	17: 38,055,329	Y79C	possibly damaging	Het
Olfr420	A	T	1: 174,158,859	I29F	probably benign	Het
Olfr97	T	C	17: 37,232,310	E20G	probably benign	Het
Osbpl6	G	A	2: 76,593,387	A857T	probably damaging	Het
Oscp1	C	A	4: 126,088,408	D380E	probably benign	Het
Pdzd7	C	A	19: 45,039,239	R265S	probably benign	Het
Piezo2	A	T	18: 63,113,876		probably null	Het
Pigc	G	A	1: 161,970,464	R5H	probably benign	Het
Pla2g5	C	A	4: 138,804,534	R53L	probably benign	Het
Rbm6	T	C	9: 107,852,706	R248G	probably damaging	Het
Rev1	A	T	1: 38,056,445	L877Q	probably damaging	Het
Rpap3	A	T	15: 97,681,708	N474K	probably benign	Het
Ryr2	T	A	13: 11,827,607	E468V	possibly damaging	Het
Samd9l	A	C	6: 3,374,749	D837E	probably benign	Het
Sipa1l2	T	C	8: 125,451,988	N1124S	probably damaging	Het
Slc11a2	G	A	15: 100,409,261	A83V	possibly damaging	Het
Slfn14	A	G	11: 83,281,817		probably null	Het
Sry	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	Y: 2,662,638		probably benign	Het
Suclg1	A	G	6: 73,275,243		probably null	Het
Syne1	A	C	10: 5,342,293	V1325G	probably damaging	Het
Tmprss15	T	C	16: 78,987,650	S706G	probably benign	Het
Tox2	T	C	2: 163,320,376	Y389H	probably damaging	Het
Trappc10	T	C	10: 78,199,075	T946A	probably benign	Het
Ubqln1	C	T	13: 58,177,905	E546K	probably damaging	Het
Zfp106	A	G	2: 120,524,057	V1411A	possibly damaging	Het
Zkscan5	A	T	5: 145,218,703	K395*	probably null	Het

Other mutations in Loxhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Loxhd1	APN	18	77395450	missense	probably damaging	0.99
IGL00490:Loxhd1	APN	18	77431074	missense	possibly damaging	0.94
IGL00507:Loxhd1	APN	18	77332567	missense	probably benign	0.03
IGL00546:Loxhd1	APN	18	77405976	missense	probably damaging	0.97
IGL01369:Loxhd1	APN	18	77329201	missense	possibly damaging	0.85
IGL01767:Loxhd1	APN	18	77286424	missense	possibly damaging	0.71
IGL02245:Loxhd1	APN	18	77340101	missense	possibly damaging	0.71
IGL02388:Loxhd1	APN	18	77369137	missense	probably benign	0.18
IGL02410:Loxhd1	APN	18	77402952	missense	probably benign	0.02
IGL02593:Loxhd1	APN	18	77410539	missense	possibly damaging	0.91
IGL02632:Loxhd1	APN	18	77405932	missense	probably damaging	0.99
IGL02692:Loxhd1	APN	18	77356913	missense	probably damaging	0.99
IGL02796:Loxhd1	APN	18	77369115	splice site	probably benign
IGL03032:Loxhd1	APN	18	77286473	missense	possibly damaging	0.93
IGL03074:Loxhd1	APN	18	77441784	missense	possibly damaging	0.75
IGL03094:Loxhd1	APN	18	77431113	missense	possibly damaging	0.88
IGL03118:Loxhd1	APN	18	77380464	missense	probably damaging	1.00
IGL03232:Loxhd1	APN	18	77408750	missense	probably damaging	1.00
IGL03377:Loxhd1	APN	18	77441673	missense	possibly damaging	0.91
H8562:Loxhd1	UTSW	18	77341931	missense	possibly damaging	0.93
PIT4494001:Loxhd1	UTSW	18	77441768	missense	probably damaging	0.99
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0048:Loxhd1	UTSW	18	77408778	missense	probably damaging	0.99
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0208:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0323:Loxhd1	UTSW	18	77369137	missense	probably benign	0.18
R0332:Loxhd1	UTSW	18	77383830	splice site	probably null
R0367:Loxhd1	UTSW	18	77425757	splice site	probably benign
R0709:Loxhd1	UTSW	18	77404969	missense	probably benign	0.23
R0783:Loxhd1	UTSW	18	77429984	missense	possibly damaging	0.58
R1132:Loxhd1	UTSW	18	77429943	missense	possibly damaging	0.71
R1232:Loxhd1	UTSW	18	77406003	critical splice donor site	probably null
R1331:Loxhd1	UTSW	18	77402936	missense	possibly damaging	0.86
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1501:Loxhd1	UTSW	18	77356832	missense	probably damaging	1.00
R1640:Loxhd1	UTSW	18	77402563	missense	probably damaging	1.00
R1656:Loxhd1	UTSW	18	77321668	missense	possibly damaging	0.71
R1671:Loxhd1	UTSW	18	77404802	missense	probably damaging	1.00
R1725:Loxhd1	UTSW	18	77293241	missense	probably benign	0.32
R1735:Loxhd1	UTSW	18	77404889	missense	probably damaging	0.98
R1796:Loxhd1	UTSW	18	77405907	missense	probably damaging	0.96
R1796:Loxhd1	UTSW	18	77425639	missense	possibly damaging	0.88
R1800:Loxhd1	UTSW	18	77402502	missense	probably damaging	1.00
R1848:Loxhd1	UTSW	18	77281971	missense	possibly damaging	0.53
R1912:Loxhd1	UTSW	18	77340137	missense	probably benign	0.32
R1945:Loxhd1	UTSW	18	77404808	missense	probably damaging	1.00
R1978:Loxhd1	UTSW	18	77321642	missense	possibly damaging	0.86
R1997:Loxhd1	UTSW	18	77295769	missense	probably damaging	0.98
R2086:Loxhd1	UTSW	18	77384946	missense	probably damaging	1.00
R2153:Loxhd1	UTSW	18	77356166	missense	possibly damaging	0.72
R3124:Loxhd1	UTSW	18	77431078	missense	probably damaging	0.97
R3896:Loxhd1	UTSW	18	77382023	missense	possibly damaging	0.65
R3907:Loxhd1	UTSW	18	77408768	missense	possibly damaging	0.60
R3980:Loxhd1	UTSW	18	77414159	missense	probably damaging	1.00
R4165:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4166:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4176:Loxhd1	UTSW	18	77331059	missense	possibly damaging	0.53
R4345:Loxhd1	UTSW	18	77399001	missense	possibly damaging	0.89
R4354:Loxhd1	UTSW	18	77395427	missense	probably damaging	1.00
R4385:Loxhd1	UTSW	18	77372911	missense	probably damaging	0.99
R4402:Loxhd1	UTSW	18	77441760	missense	possibly damaging	0.94
R4404:Loxhd1	UTSW	18	77431132	missense	probably damaging	1.00
R4456:Loxhd1	UTSW	18	77399089	missense	probably damaging	1.00
R4525:Loxhd1	UTSW	18	77356912	missense	probably damaging	0.98
R4605:Loxhd1	UTSW	18	77405946	missense	probably benign	0.00
R4661:Loxhd1	UTSW	18	77402885	missense	possibly damaging	0.79
R4698:Loxhd1	UTSW	18	77372291	missense	possibly damaging	0.82
R4725:Loxhd1	UTSW	18	77395457	missense	probably damaging	1.00
R4820:Loxhd1	UTSW	18	77384967	missense	probably damaging	1.00
R5163:Loxhd1	UTSW	18	77361736	missense	possibly damaging	0.92
R5288:Loxhd1	UTSW	18	77363612	missense	probably damaging	1.00
R5328:Loxhd1	UTSW	18	77410572	missense	probably damaging	1.00
R5329:Loxhd1	UTSW	18	77332682	missense	probably damaging	0.98
R5347:Loxhd1	UTSW	18	77366541	missense	probably damaging	1.00
R5589:Loxhd1	UTSW	18	77342055	missense	possibly damaging	0.86
R5616:Loxhd1	UTSW	18	77404951	missense	probably damaging	1.00
R5703:Loxhd1	UTSW	18	77356877	missense	probably damaging	1.00
R5837:Loxhd1	UTSW	18	77286409	missense	possibly damaging	0.71
R5888:Loxhd1	UTSW	18	77402515	missense	probably damaging	0.99
R6021:Loxhd1	UTSW	18	77412250	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6153:Loxhd1	UTSW	18	77295758	missense	possibly damaging	0.71
R6174:Loxhd1	UTSW	18	77412178	missense	probably damaging	1.00
R6265:Loxhd1	UTSW	18	77361730	missense	probably damaging	0.99
R6377:Loxhd1	UTSW	18	77380432	missense	probably damaging	1.00
R6530:Loxhd1	UTSW	18	77412151	missense	probably benign	0.30
R6555:Loxhd1	UTSW	18	77293269	missense	possibly damaging	0.51
R6782:Loxhd1	UTSW	18	77431177	missense	probably damaging	0.99
R6834:Loxhd1	UTSW	18	77441526	missense	probably damaging	1.00
R7000:Loxhd1	UTSW	18	77372433	critical splice donor site	probably null
R7112:Loxhd1	UTSW	18	77388514	missense	probably damaging	1.00
R7203:Loxhd1	UTSW	18	77414196	missense	probably damaging	0.97
R7206:Loxhd1	UTSW	18	77441817	missense	probably damaging	0.97
R7260:Loxhd1	UTSW	18	77332642	missense	possibly damaging	0.93
R7432:Loxhd1	UTSW	18	77295851	missense	possibly damaging	0.51
R7475:Loxhd1	UTSW	18	77412305	missense	possibly damaging	0.83
R7555:Loxhd1	UTSW	18	77395365	missense	probably damaging	0.99
R7590:Loxhd1	UTSW	18	77321634	missense	possibly damaging	0.84
R7612:Loxhd1	UTSW	18	77429975	missense	possibly damaging	0.95
R7626:Loxhd1	UTSW	18	77431186	missense	possibly damaging	0.75
R7768:Loxhd1	UTSW	18	77384941	missense	probably damaging	0.99
R7791:Loxhd1	UTSW	18	77383729	missense	probably damaging	1.00
R7884:Loxhd1	UTSW	18	77431213	missense	probably damaging	0.98
R7960:Loxhd1	UTSW	18	77385050	missense	probably damaging	0.99
R7986:Loxhd1	UTSW	18	77375194	missense	possibly damaging	0.88
R8042:Loxhd1	UTSW	18	77431192	missense	probably damaging	0.99
R8084:Loxhd1	UTSW	18	77340149	missense	possibly damaging	0.71
R8088:Loxhd1	UTSW	18	77342013	missense	possibly damaging	0.52
R8100:Loxhd1	UTSW	18	77404816	missense	possibly damaging	0.69
R8139:Loxhd1	UTSW	18	77380496	missense	possibly damaging	0.95
R8152:Loxhd1	UTSW	18	77388399	missense	possibly damaging	0.62
R8199:Loxhd1	UTSW	18	77381638	missense	possibly damaging	0.77
R8246:Loxhd1	UTSW	18	77363546	missense	possibly damaging	0.71
R8263:Loxhd1	UTSW	18	77375162	missense	probably damaging	1.00
R8324:Loxhd1	UTSW	18	77339579	critical splice donor site	probably null
R8342:Loxhd1	UTSW	18	77405985	missense	possibly damaging	0.88
R8401:Loxhd1	UTSW	18	77380460	missense	probably damaging	1.00
R8480:Loxhd1	UTSW	18	77431131	missense	probably damaging	1.00
R8490:Loxhd1	UTSW	18	77441466	missense	possibly damaging	0.96
X0020:Loxhd1	UTSW	18	77339562	nonsense	probably null
X0024:Loxhd1	UTSW	18	77395403	missense	probably damaging	1.00
X0062:Loxhd1	UTSW	18	77441516	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGGCATGGAGAGCATGTC -3'
(R):5'- GGCATTGGTACTTAAGGAATGC -3'

Sequencing Primer
(F):5'- GAGCATGTCTCTCCTCCCTAGG -3'
(R):5'- CCAGAGGAGGGATATTTACTCTTAC -3'

Posted On

2019-12-03