Incidental Mutation 'R7830:Scarb1'
ID 602367
Institutional Source Beutler Lab
Gene Symbol Scarb1
Ensembl Gene ENSMUSG00000037936
Gene Name scavenger receptor class B, member 1
Synonyms Cd36l1, Srb1, Hdlq1, SRBI, Hlb398, Cla-1, SR-BI, D5Ertd460e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7830 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 125277087-125341094 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 125287383 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 94 (Y94C)
Ref Sequence ENSEMBL: ENSMUSP00000122100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086075] [ENSMUST00000111390] [ENSMUST00000127148]
AlphaFold Q61009
Predicted Effect probably damaging
Transcript: ENSMUST00000086075
AA Change: Y393C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083242
Gene: ENSMUSG00000037936
AA Change: Y393C

DomainStartEndE-ValueType
Pfam:CD36 16 463 6.4e-154 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111390
AA Change: Y393C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107021
Gene: ENSMUSG00000037936
AA Change: Y393C

DomainStartEndE-ValueType
Pfam:CD36 14 465 4.7e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127148
AA Change: Y94C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122100
Gene: ENSMUSG00000037936
AA Change: Y94C

DomainStartEndE-ValueType
Pfam:CD36 1 123 1.2e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma membrane receptor for high density lipoprotein cholesterol (HDL). The encoded protein mediates cholesterol transfer to and from HDL. In addition, this protein is a receptor for hepatitis C virus glycoprotein E2. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Targeted mutations result in abnormal lipoprotein metablolism and, for one allele, reversible female infertility. An ENU mutant shows increased cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,168,871 N24S probably benign Het
4932438A13Rik CCAGATTCATGTAGCA CCA 3: 36,964,932 probably null Het
Adat3 T C 10: 80,606,820 L164P probably damaging Het
Aldh16a1 A T 7: 45,146,225 L388Q probably damaging Het
Angpt1 T C 15: 42,676,268 N65S probably damaging Het
Ankrd54 G A 15: 79,054,050 T287I probably damaging Het
Cc2d2b T A 19: 40,765,357 V108E possibly damaging Het
Cntnap5c A T 17: 58,162,250 D609V probably damaging Het
Col6a4 G T 9: 106,075,390 D436E probably damaging Het
Cul9 A T 17: 46,540,311 D394E probably benign Het
Cyfip1 A G 7: 55,873,462 E75G probably damaging Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Eif2ak2 C T 17: 78,866,403 G249S probably damaging Het
Erich4 A T 7: 25,615,724 M42K probably benign Het
Fig4 A C 10: 41,256,466 V448G probably benign Het
Gas1 T C 13: 60,176,034 D303G probably damaging Het
Gm609 A T 16: 45,442,554 I187N probably damaging Het
Golgb1 T G 16: 36,898,721 Y330D possibly damaging Het
Gpr146 C T 5: 139,392,602 A53V probably benign Het
Klk1b27 A C 7: 44,055,726 M106L probably benign Het
Lipc T C 9: 70,812,901 T190A probably damaging Het
Lrrc4b A G 7: 44,461,807 I368V possibly damaging Het
Mmp10 A T 9: 7,507,283 Q368L probably benign Het
Myo10 T A 15: 25,737,971 Y501* probably null Het
Neb T A 2: 52,165,189 H6445L probably benign Het
Numa1 T A 7: 101,999,285 M741K probably benign Het
Nxn T A 11: 76,273,993 I231F probably damaging Het
Olfr1471 T C 19: 13,445,621 L203S probably benign Het
Olfr341 A G 2: 36,479,380 L250P probably damaging Het
Osbp2 A G 11: 3,863,414 S152P probably benign Het
P3h4 T C 11: 100,414,043 T173A probably damaging Het
Pcdh15 C A 10: 74,385,901 R678S probably damaging Het
Pcdhb6 C A 18: 37,336,312 T762K probably benign Het
Pnrc1 G A 4: 33,248,057 P114L probably damaging Het
Ppp3ca T A 3: 136,868,720 S126R probably damaging Het
Prl3d2 C T 13: 27,126,017 T155I probably benign Het
Prune2 C A 19: 17,122,674 N1847K probably benign Het
Psg21 A T 7: 18,647,298 V440E probably damaging Het
Rag1 A G 2: 101,642,059 S913P probably damaging Het
Ros1 T A 10: 52,154,934 H525L probably damaging Het
Serpinb6a T G 13: 33,930,047 D120A probably benign Het
Sik3 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 9: 46,212,057 probably benign Het
Slc39a14 T C 14: 70,310,117 D299G probably benign Het
Sox1 G A 8: 12,396,955 A199T probably damaging Het
Strc T A 2: 121,375,049 I867F probably damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Usf3 C T 16: 44,219,779 Q1541* probably null Het
Wrn G A 8: 33,269,054 L716F probably damaging Het
Zfp141 G A 7: 42,475,188 T620I probably benign Het
Zfp354b A T 11: 50,923,309 I263K probably benign Het
Zfp804b T A 5: 6,771,124 E646D probably benign Het
Zfp970 G T 2: 177,475,545 C304F probably damaging Het
Other mutations in Scarb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03355:Scarb1 APN 5 125289702 missense probably benign 0.01
IGL03052:Scarb1 UTSW 5 125294099 missense probably damaging 1.00
R0051:Scarb1 UTSW 5 125281100 splice site probably null
R0317:Scarb1 UTSW 5 125289692 missense probably damaging 0.99
R0455:Scarb1 UTSW 5 125289681 missense probably damaging 0.96
R0491:Scarb1 UTSW 5 125298731 unclassified probably benign
R0655:Scarb1 UTSW 5 125300440 missense probably damaging 1.00
R0676:Scarb1 UTSW 5 125297214 unclassified probably benign
R2074:Scarb1 UTSW 5 125294143 missense probably benign
R2267:Scarb1 UTSW 5 125287375 missense possibly damaging 0.82
R3951:Scarb1 UTSW 5 125287411 missense probably damaging 0.99
R4080:Scarb1 UTSW 5 125277795 missense probably damaging 1.00
R4452:Scarb1 UTSW 5 125300345 missense probably damaging 1.00
R4925:Scarb1 UTSW 5 125297299 missense probably damaging 1.00
R5669:Scarb1 UTSW 5 125300387 missense probably damaging 1.00
R5809:Scarb1 UTSW 5 125304222 missense probably damaging 0.98
R5872:Scarb1 UTSW 5 125304277 missense possibly damaging 0.60
R5883:Scarb1 UTSW 5 125340907 unclassified probably benign
R6321:Scarb1 UTSW 5 125304331 missense probably damaging 1.00
R6508:Scarb1 UTSW 5 125304325 missense possibly damaging 0.49
R6618:Scarb1 UTSW 5 125304330 missense probably damaging 0.96
R6931:Scarb1 UTSW 5 125284719 missense probably damaging 1.00
R7058:Scarb1 UTSW 5 125297230 missense probably damaging 1.00
R7099:Scarb1 UTSW 5 125304350 missense probably damaging 0.98
R7146:Scarb1 UTSW 5 125284025 missense probably benign
R7873:Scarb1 UTSW 5 125294039 missense probably damaging 1.00
R8158:Scarb1 UTSW 5 125303137 missense probably benign 0.01
R8467:Scarb1 UTSW 5 125298667 missense probably damaging 0.99
R8500:Scarb1 UTSW 5 125294163 missense probably damaging 1.00
R8814:Scarb1 UTSW 5 125294092 missense probably benign 0.00
R9025:Scarb1 UTSW 5 125304350 missense probably damaging 0.98
R9169:Scarb1 UTSW 5 125294082 missense probably damaging 1.00
R9462:Scarb1 UTSW 5 125340827 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTAGTGTCAGGATGCAGC -3'
(R):5'- GGAAATTTCTAGAAGGGTGGATGCC -3'

Sequencing Primer
(F):5'- GTCTGAGTCTCCATCCAGAGCAATG -3'
(R):5'- CCCCAGCAGGTATTATCTGGTTTAAG -3'
Posted On 2019-12-03