Incidental Mutation 'R7830:Psg21'
ID 602369
Institutional Source Beutler Lab
Gene Symbol Psg21
Ensembl Gene ENSMUSG00000070796
Gene Name pregnancy-specific glycoprotein 21
Synonyms 1600026N13Rik, 1600019C01Rik, 1600025N01Rik, cea8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock # R7830 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 18646736-18656725 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 18647298 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 440 (V440E)
Ref Sequence ENSEMBL: ENSMUSP00000092387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094793] [ENSMUST00000182128]
AlphaFold Q9DAV5
Predicted Effect probably damaging
Transcript: ENSMUST00000094793
AA Change: V440E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092387
Gene: ENSMUSG00000070796
AA Change: V440E

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
IGc2 393 457 1.47e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182128
SMART Domains Protein: ENSMUSP00000138173
Gene: ENSMUSG00000070796

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,168,871 N24S probably benign Het
4932438A13Rik CCAGATTCATGTAGCA CCA 3: 36,964,932 probably null Het
Adat3 T C 10: 80,606,820 L164P probably damaging Het
Aldh16a1 A T 7: 45,146,225 L388Q probably damaging Het
Angpt1 T C 15: 42,676,268 N65S probably damaging Het
Ankrd54 G A 15: 79,054,050 T287I probably damaging Het
Cc2d2b T A 19: 40,765,357 V108E possibly damaging Het
Cntnap5c A T 17: 58,162,250 D609V probably damaging Het
Col6a4 G T 9: 106,075,390 D436E probably damaging Het
Cul9 A T 17: 46,540,311 D394E probably benign Het
Cyfip1 A G 7: 55,873,462 E75G probably damaging Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Eif2ak2 C T 17: 78,866,403 G249S probably damaging Het
Erich4 A T 7: 25,615,724 M42K probably benign Het
Fig4 A C 10: 41,256,466 V448G probably benign Het
Gas1 T C 13: 60,176,034 D303G probably damaging Het
Gm609 A T 16: 45,442,554 I187N probably damaging Het
Golgb1 T G 16: 36,898,721 Y330D possibly damaging Het
Gpr146 C T 5: 139,392,602 A53V probably benign Het
Klk1b27 A C 7: 44,055,726 M106L probably benign Het
Lipc T C 9: 70,812,901 T190A probably damaging Het
Lrrc4b A G 7: 44,461,807 I368V possibly damaging Het
Mmp10 A T 9: 7,507,283 Q368L probably benign Het
Myo10 T A 15: 25,737,971 Y501* probably null Het
Neb T A 2: 52,165,189 H6445L probably benign Het
Numa1 T A 7: 101,999,285 M741K probably benign Het
Nxn T A 11: 76,273,993 I231F probably damaging Het
Olfr1471 T C 19: 13,445,621 L203S probably benign Het
Olfr341 A G 2: 36,479,380 L250P probably damaging Het
Osbp2 A G 11: 3,863,414 S152P probably benign Het
P3h4 T C 11: 100,414,043 T173A probably damaging Het
Pcdh15 C A 10: 74,385,901 R678S probably damaging Het
Pcdhb6 C A 18: 37,336,312 T762K probably benign Het
Pnrc1 G A 4: 33,248,057 P114L probably damaging Het
Ppp3ca T A 3: 136,868,720 S126R probably damaging Het
Prl3d2 C T 13: 27,126,017 T155I probably benign Het
Prune2 C A 19: 17,122,674 N1847K probably benign Het
Rag1 A G 2: 101,642,059 S913P probably damaging Het
Ros1 T A 10: 52,154,934 H525L probably damaging Het
Scarb1 T C 5: 125,287,383 Y94C probably damaging Het
Serpinb6a T G 13: 33,930,047 D120A probably benign Het
Sik3 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 9: 46,212,057 probably benign Het
Slc39a14 T C 14: 70,310,117 D299G probably benign Het
Sox1 G A 8: 12,396,955 A199T probably damaging Het
Strc T A 2: 121,375,049 I867F probably damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Usf3 C T 16: 44,219,779 Q1541* probably null Het
Wrn G A 8: 33,269,054 L716F probably damaging Het
Zfp141 G A 7: 42,475,188 T620I probably benign Het
Zfp354b A T 11: 50,923,309 I263K probably benign Het
Zfp804b T A 5: 6,771,124 E646D probably benign Het
Zfp970 G T 2: 177,475,545 C304F probably damaging Het
Other mutations in Psg21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Psg21 APN 7 18654825 missense probably damaging 1.00
IGL02390:Psg21 APN 7 18652631 missense probably benign 0.11
IGL02548:Psg21 APN 7 18655036 missense possibly damaging 0.89
IGL03001:Psg21 APN 7 18652485 missense probably benign 0.03
IGL03135:Psg21 APN 7 18654918 missense probably benign 0.00
R0131:Psg21 UTSW 7 18654868 missense probably benign 0.39
R0551:Psg21 UTSW 7 18652640 critical splice acceptor site probably null
R1512:Psg21 UTSW 7 18656500 missense probably benign 0.00
R1874:Psg21 UTSW 7 18650816 missense probably benign 0.15
R1993:Psg21 UTSW 7 18654770 missense probably benign 0.04
R2327:Psg21 UTSW 7 18652453 missense possibly damaging 0.61
R3414:Psg21 UTSW 7 18652380 missense probably damaging 1.00
R4422:Psg21 UTSW 7 18647332 missense probably damaging 1.00
R5138:Psg21 UTSW 7 18656528 start codon destroyed probably null 0.94
R5623:Psg21 UTSW 7 18655014 missense probably damaging 1.00
R5686:Psg21 UTSW 7 18652258 intron probably benign
R6166:Psg21 UTSW 7 18656739 unclassified probably benign
R6177:Psg21 UTSW 7 18652354 missense possibly damaging 0.64
R6190:Psg21 UTSW 7 18655001 missense possibly damaging 0.61
R6210:Psg21 UTSW 7 18652345 missense probably damaging 1.00
R6482:Psg21 UTSW 7 18654739 splice site probably null
R6729:Psg21 UTSW 7 18652591 missense probably damaging 1.00
R6866:Psg21 UTSW 7 18652284 missense probably damaging 1.00
R6992:Psg21 UTSW 7 18654743 critical splice donor site probably null
R7075:Psg21 UTSW 7 18654861 missense probably damaging 1.00
R7081:Psg21 UTSW 7 18654849 nonsense probably null
R7098:Psg21 UTSW 7 18652545 missense probably damaging 1.00
R7582:Psg21 UTSW 7 18647203 makesense probably null
R7588:Psg21 UTSW 7 18647209 missense probably benign 0.00
R7607:Psg21 UTSW 7 18654783 missense probably benign 0.02
R7964:Psg21 UTSW 7 18647211 missense probably benign 0.01
R8758:Psg21 UTSW 7 18650753 missense probably damaging 1.00
R8972:Psg21 UTSW 7 18647368 missense probably benign 0.03
R8988:Psg21 UTSW 7 18652464 missense probably benign 0.00
R9119:Psg21 UTSW 7 18647484 missense probably benign 0.14
R9446:Psg21 UTSW 7 18654940 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATAGTGAGCAGAGCAGTGTG -3'
(R):5'- GCCATGAGAGTCACGGACA -3'

Sequencing Primer
(F):5'- TCCAGTACCAAGATAGCATGCATGG -3'
(R):5'- TCACGGACAGCACAGTTAG -3'
Posted On 2019-12-03