Incidental Mutation 'R7830:Klk1b27'
ID602372
Institutional Source Beutler Lab
Gene Symbol Klk1b27
Ensembl Gene ENSMUSG00000063177
Gene Namekallikrein 1-related peptidase b27
SynonymsmGK-27, Klk27, Klk21l
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7830 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location44052290-44056712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 44055726 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 106 (M106L)
Ref Sequence ENSEMBL: ENSMUSP00000078786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079859]
Predicted Effect probably benign
Transcript: ENSMUST00000079859
AA Change: M106L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078786
Gene: ENSMUSG00000063177
AA Change: M106L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 255 1.87e-97 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,168,871 N24S probably benign Het
4932438A13Rik CCAGATTCATGTAGCA CCA 3: 36,964,932 probably null Het
Adat3 T C 10: 80,606,820 L164P probably damaging Het
Aldh16a1 A T 7: 45,146,225 L388Q probably damaging Het
Angpt1 T C 15: 42,676,268 N65S probably damaging Het
Ankrd54 G A 15: 79,054,050 T287I probably damaging Het
Cc2d2b T A 19: 40,765,357 V108E possibly damaging Het
Cntnap5c A T 17: 58,162,250 D609V probably damaging Het
Col6a4 G T 9: 106,075,390 D436E probably damaging Het
Cul9 A T 17: 46,540,311 D394E probably benign Het
Cyfip1 A G 7: 55,873,462 E75G probably damaging Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Eif2ak2 C T 17: 78,866,403 G249S probably damaging Het
Erich4 A T 7: 25,615,724 M42K probably benign Het
Fig4 A C 10: 41,256,466 V448G probably benign Het
Gas1 T C 13: 60,176,034 D303G probably damaging Het
Gm609 A T 16: 45,442,554 I187N probably damaging Het
Golgb1 T G 16: 36,898,721 Y330D possibly damaging Het
Gpr146 C T 5: 139,392,602 A53V probably benign Het
Lipc T C 9: 70,812,901 T190A probably damaging Het
Lrrc4b A G 7: 44,461,807 I368V possibly damaging Het
Mmp10 A T 9: 7,507,283 Q368L probably benign Het
Myo10 T A 15: 25,737,971 Y501* probably null Het
Neb T A 2: 52,165,189 H6445L probably benign Het
Numa1 T A 7: 101,999,285 M741K probably benign Het
Nxn T A 11: 76,273,993 I231F probably damaging Het
Olfr1471 T C 19: 13,445,621 L203S probably benign Het
Olfr341 A G 2: 36,479,380 L250P probably damaging Het
Osbp2 A G 11: 3,863,414 S152P probably benign Het
P3h4 T C 11: 100,414,043 T173A probably damaging Het
Pcdh15 C A 10: 74,385,901 R678S probably damaging Het
Pcdhb6 C A 18: 37,336,312 T762K probably benign Het
Pnrc1 G A 4: 33,248,057 P114L probably damaging Het
Ppp3ca T A 3: 136,868,720 S126R probably damaging Het
Prl3d2 C T 13: 27,126,017 T155I probably benign Het
Prune2 C A 19: 17,122,674 N1847K probably benign Het
Psg21 A T 7: 18,647,298 V440E probably damaging Het
Rag1 A G 2: 101,642,059 S913P probably damaging Het
Ros1 T A 10: 52,154,934 H525L probably damaging Het
Scarb1 T C 5: 125,287,383 Y94C probably damaging Het
Serpinb6a T G 13: 33,930,047 D120A probably benign Het
Sik3 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 9: 46,212,057 probably benign Het
Slc39a14 T C 14: 70,310,117 D299G probably benign Het
Sox1 G A 8: 12,396,955 A199T probably damaging Het
Strc T A 2: 121,375,049 I867F probably damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Usf3 C T 16: 44,219,779 Q1541* probably null Het
Wrn G A 8: 33,269,054 L716F probably damaging Het
Zfp141 G A 7: 42,475,188 T620I probably benign Het
Zfp354b A T 11: 50,923,309 I263K probably benign Het
Zfp804b T A 5: 6,771,124 E646D probably benign Het
Zfp970 G T 2: 177,475,545 C304F probably damaging Het
Other mutations in Klk1b27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Klk1b27 APN 7 44056143 critical splice donor site probably null
IGL01328:Klk1b27 APN 7 44055879 missense probably damaging 1.00
IGL01552:Klk1b27 APN 7 44054615 missense probably damaging 1.00
IGL01632:Klk1b27 APN 7 44056673 utr 3 prime probably benign
R0574:Klk1b27 UTSW 7 44056101 missense probably damaging 1.00
R4723:Klk1b27 UTSW 7 44056532 missense probably damaging 1.00
R5800:Klk1b27 UTSW 7 44055664 missense probably benign 0.21
R6002:Klk1b27 UTSW 7 44055690 missense probably benign
R6244:Klk1b27 UTSW 7 44054550 missense probably benign 0.05
R6513:Klk1b27 UTSW 7 44055745 missense probably benign 0.00
R6584:Klk1b27 UTSW 7 44054511 missense possibly damaging 0.84
R6633:Klk1b27 UTSW 7 44055810 missense probably damaging 0.98
R7074:Klk1b27 UTSW 7 44056553 missense probably damaging 1.00
R7495:Klk1b27 UTSW 7 44056076 missense probably benign
R8002:Klk1b27 UTSW 7 44056021 missense probably benign 0.01
X0024:Klk1b27 UTSW 7 44056593 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AAGTTCAGCCCTGTCCTAGC -3'
(R):5'- CCACACCAAGCTGTATCCTTG -3'

Sequencing Primer
(F):5'- TGAGCAGCTCTCAGGCCTTC -3'
(R):5'- GCTGTATCCTTGGAGAAGACTCAC -3'
Posted On2019-12-03