Incidental Mutation 'R7830:Myo10'
ID 602395
Institutional Source Beutler Lab
Gene Symbol Myo10
Ensembl Gene ENSMUSG00000022272
Gene Name myosin X
Synonyms myosin-X, D15Ertd600e
MMRRC Submission 045884-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7830 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 25622636-25813759 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 25738057 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 501 (Y501*)
Ref Sequence ENSEMBL: ENSMUSP00000118280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110457] [ENSMUST00000137601]
AlphaFold F8VQB6
Predicted Effect probably null
Transcript: ENSMUST00000110457
AA Change: Y534*
SMART Domains Protein: ENSMUSP00000106087
Gene: ENSMUSG00000022272
AA Change: Y534*

DomainStartEndE-ValueType
MYSc 57 740 N/A SMART
IQ 741 763 1.27e-3 SMART
IQ 764 786 1.06e0 SMART
IQ 787 809 7.07e-2 SMART
Pfam:MYO10_CC 881 932 4.2e-22 PFAM
low complexity region 959 981 N/A INTRINSIC
low complexity region 1090 1102 N/A INTRINSIC
low complexity region 1147 1165 N/A INTRINSIC
PH 1217 1316 1.39e-21 SMART
PH 1397 1503 6.76e-11 SMART
MyTH4 1551 1699 4.12e-37 SMART
B41 1700 1962 1.72e-44 SMART
low complexity region 2050 2062 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135981
SMART Domains Protein: ENSMUSP00000123057
Gene: ENSMUSG00000022272

DomainStartEndE-ValueType
PDB:2DFS|M 2 38 6e-7 PDB
Blast:MYSc 2 42 3e-19 BLAST
IQ 59 81 1.27e-3 SMART
IQ 82 104 1.06e0 SMART
IQ 105 127 7.07e-2 SMART
Pfam:MYO10_CC 199 242 1.7e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000137601
AA Change: Y501*
SMART Domains Protein: ENSMUSP00000118280
Gene: ENSMUSG00000022272
AA Change: Y501*

DomainStartEndE-ValueType
MYSc 24 707 N/A SMART
IQ 708 730 1.27e-3 SMART
IQ 731 753 1.06e0 SMART
IQ 754 776 7.07e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-10 (MYH10). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. This gene functions as an actin-based molecular motor and plays a role in integration of F-actin and microtubule cytoskeletons during meiosis. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutations are semi-lethal with over half of homozygous embryos exhibiting exencephaly. Surviving mutants show decreased body weight, white spotting, syndactyly, persistence of hyaloid vascular system and other eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat3 T C 10: 80,442,654 (GRCm39) L164P probably damaging Het
Aldh16a1 A T 7: 44,795,649 (GRCm39) L388Q probably damaging Het
Angpt1 T C 15: 42,539,664 (GRCm39) N65S probably damaging Het
Ankrd54 G A 15: 78,938,250 (GRCm39) T287I probably damaging Het
Bltp1 CCAGATTCATGTAGCA CCA 3: 37,019,081 (GRCm39) probably null Het
Cc2d2b T A 19: 40,753,801 (GRCm39) V108E possibly damaging Het
Cd200l1 A T 16: 45,262,917 (GRCm39) I187N probably damaging Het
Cntnap5c A T 17: 58,469,245 (GRCm39) D609V probably damaging Het
Col6a4 G T 9: 105,952,589 (GRCm39) D436E probably damaging Het
Cul9 A T 17: 46,851,237 (GRCm39) D394E probably benign Het
Cyfip1 A G 7: 55,523,210 (GRCm39) E75G probably damaging Het
Efr3a G A 15: 65,701,679 (GRCm39) V198I probably benign Het
Eif2ak2 C T 17: 79,173,832 (GRCm39) G249S probably damaging Het
Erich4 A T 7: 25,315,149 (GRCm39) M42K probably benign Het
Fig4 A C 10: 41,132,462 (GRCm39) V448G probably benign Het
Gas1 T C 13: 60,323,848 (GRCm39) D303G probably damaging Het
Golgb1 T G 16: 36,719,083 (GRCm39) Y330D possibly damaging Het
Gpr146 C T 5: 139,378,357 (GRCm39) A53V probably benign Het
Klk1b27 A C 7: 43,705,150 (GRCm39) M106L probably benign Het
Lipc T C 9: 70,720,183 (GRCm39) T190A probably damaging Het
Lrrc4b A G 7: 44,111,231 (GRCm39) I368V possibly damaging Het
Mmp10 A T 9: 7,507,284 (GRCm39) Q368L probably benign Het
Neb T A 2: 52,055,201 (GRCm39) H6445L probably benign Het
Numa1 T A 7: 101,648,492 (GRCm39) M741K probably benign Het
Nxn T A 11: 76,164,819 (GRCm39) I231F probably damaging Het
Or1j13 A G 2: 36,369,392 (GRCm39) L250P probably damaging Het
Or5b116 T C 19: 13,422,985 (GRCm39) L203S probably benign Het
Osbp2 A G 11: 3,813,414 (GRCm39) S152P probably benign Het
P3h4 T C 11: 100,304,869 (GRCm39) T173A probably damaging Het
Pcdh15 C A 10: 74,221,733 (GRCm39) R678S probably damaging Het
Pcdhb6 C A 18: 37,469,365 (GRCm39) T762K probably benign Het
Pnrc1 G A 4: 33,248,057 (GRCm39) P114L probably damaging Het
Ppp3ca T A 3: 136,574,481 (GRCm39) S126R probably damaging Het
Prl3d2 C T 13: 27,310,000 (GRCm39) T155I probably benign Het
Prune2 C A 19: 17,100,038 (GRCm39) N1847K probably benign Het
Psg21 A T 7: 18,381,223 (GRCm39) V440E probably damaging Het
Rag1 A G 2: 101,472,404 (GRCm39) S913P probably damaging Het
Rmc1 A G 18: 12,301,928 (GRCm39) N24S probably benign Het
Ros1 T A 10: 52,031,030 (GRCm39) H525L probably damaging Het
Scarb1 T C 5: 125,364,447 (GRCm39) Y94C probably damaging Het
Serpinb6a T G 13: 34,114,030 (GRCm39) D120A probably benign Het
Sik3 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 9: 46,123,355 (GRCm39) probably benign Het
Slc39a14 T C 14: 70,547,566 (GRCm39) D299G probably benign Het
Sox1 G A 8: 12,446,955 (GRCm39) A199T probably damaging Het
Strc T A 2: 121,205,530 (GRCm39) I867F probably damaging Het
Tfrc A G 16: 32,437,985 (GRCm39) K346R probably benign Het
Usf3 C T 16: 44,040,142 (GRCm39) Q1541* probably null Het
Wrn G A 8: 33,759,082 (GRCm39) L716F probably damaging Het
Zfp141 G A 7: 42,124,612 (GRCm39) T620I probably benign Het
Zfp354b A T 11: 50,814,136 (GRCm39) I263K probably benign Het
Zfp804b T A 5: 6,821,124 (GRCm39) E646D probably benign Het
Zfp970 G T 2: 177,167,338 (GRCm39) C304F probably damaging Het
Other mutations in Myo10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Myo10 APN 15 25,776,466 (GRCm39) missense probably damaging 1.00
IGL01068:Myo10 APN 15 25,739,395 (GRCm39) missense possibly damaging 0.93
IGL01352:Myo10 APN 15 25,701,783 (GRCm39) missense probably damaging 1.00
IGL01388:Myo10 APN 15 25,736,703 (GRCm39) missense possibly damaging 0.55
IGL01460:Myo10 APN 15 25,714,194 (GRCm39) missense probably benign 0.00
IGL01553:Myo10 APN 15 25,776,415 (GRCm39) missense probably damaging 1.00
IGL01732:Myo10 APN 15 25,732,149 (GRCm39) missense probably benign 0.10
IGL01992:Myo10 APN 15 25,799,634 (GRCm39) missense possibly damaging 0.92
IGL02000:Myo10 APN 15 25,808,152 (GRCm39) missense probably damaging 1.00
IGL02045:Myo10 APN 15 25,726,574 (GRCm39) missense probably benign 0.03
IGL02307:Myo10 APN 15 25,776,401 (GRCm39) splice site probably benign
IGL02511:Myo10 APN 15 25,723,975 (GRCm39) missense probably damaging 0.97
IGL03240:Myo10 APN 15 25,701,688 (GRCm39) missense probably damaging 1.00
least UTSW 15 25,726,561 (GRCm39) nonsense probably null
R0037:Myo10 UTSW 15 25,666,618 (GRCm39) intron probably benign
R0153:Myo10 UTSW 15 25,781,324 (GRCm39) missense possibly damaging 0.84
R0282:Myo10 UTSW 15 25,793,253 (GRCm39) missense probably damaging 1.00
R0360:Myo10 UTSW 15 25,804,454 (GRCm39) missense probably damaging 1.00
R0585:Myo10 UTSW 15 25,736,541 (GRCm39) missense probably damaging 1.00
R0617:Myo10 UTSW 15 25,738,091 (GRCm39) missense probably damaging 1.00
R0729:Myo10 UTSW 15 25,722,243 (GRCm39) splice site probably benign
R0771:Myo10 UTSW 15 25,778,264 (GRCm39) missense probably damaging 1.00
R0960:Myo10 UTSW 15 25,801,275 (GRCm39) missense probably damaging 1.00
R1562:Myo10 UTSW 15 25,780,497 (GRCm39) missense possibly damaging 0.81
R1651:Myo10 UTSW 15 25,742,455 (GRCm39) missense probably damaging 1.00
R1789:Myo10 UTSW 15 25,726,611 (GRCm39) critical splice donor site probably null
R1816:Myo10 UTSW 15 25,800,286 (GRCm39) missense probably damaging 1.00
R1835:Myo10 UTSW 15 25,805,673 (GRCm39) missense possibly damaging 0.53
R1908:Myo10 UTSW 15 25,801,308 (GRCm39) missense probably damaging 1.00
R2082:Myo10 UTSW 15 25,786,079 (GRCm39) missense probably damaging 1.00
R2101:Myo10 UTSW 15 25,722,345 (GRCm39) missense probably benign 0.26
R2129:Myo10 UTSW 15 25,781,885 (GRCm39) missense probably benign 0.09
R2141:Myo10 UTSW 15 25,714,194 (GRCm39) missense probably benign
R2142:Myo10 UTSW 15 25,714,194 (GRCm39) missense probably benign
R2920:Myo10 UTSW 15 25,801,226 (GRCm39) missense probably damaging 1.00
R2938:Myo10 UTSW 15 25,795,803 (GRCm39) missense probably damaging 0.99
R3723:Myo10 UTSW 15 25,803,374 (GRCm39) missense probably damaging 1.00
R3852:Myo10 UTSW 15 25,779,712 (GRCm39) missense probably damaging 1.00
R4162:Myo10 UTSW 15 25,726,501 (GRCm39) splice site probably null
R4163:Myo10 UTSW 15 25,726,501 (GRCm39) splice site probably null
R4164:Myo10 UTSW 15 25,726,501 (GRCm39) splice site probably null
R4177:Myo10 UTSW 15 25,734,137 (GRCm39) missense possibly damaging 0.81
R4409:Myo10 UTSW 15 25,807,955 (GRCm39) missense probably damaging 1.00
R4667:Myo10 UTSW 15 25,793,239 (GRCm39) missense possibly damaging 0.91
R4905:Myo10 UTSW 15 25,800,298 (GRCm39) missense probably damaging 0.99
R4933:Myo10 UTSW 15 25,781,204 (GRCm39) missense probably damaging 0.96
R4968:Myo10 UTSW 15 25,808,270 (GRCm39) missense probably damaging 1.00
R5081:Myo10 UTSW 15 25,786,026 (GRCm39) missense probably damaging 1.00
R5123:Myo10 UTSW 15 25,726,569 (GRCm39) missense possibly damaging 0.94
R5310:Myo10 UTSW 15 25,778,164 (GRCm39) splice site probably null
R6073:Myo10 UTSW 15 25,736,728 (GRCm39) missense probably damaging 1.00
R6117:Myo10 UTSW 15 25,805,745 (GRCm39) missense probably benign 0.00
R6185:Myo10 UTSW 15 25,726,596 (GRCm39) missense probably damaging 0.99
R6749:Myo10 UTSW 15 25,714,196 (GRCm39) missense probably damaging 1.00
R6819:Myo10 UTSW 15 25,781,496 (GRCm39) missense possibly damaging 0.80
R6875:Myo10 UTSW 15 25,805,745 (GRCm39) missense probably benign 0.00
R6908:Myo10 UTSW 15 25,804,469 (GRCm39) missense probably damaging 1.00
R6963:Myo10 UTSW 15 25,734,149 (GRCm39) missense probably benign 0.31
R7144:Myo10 UTSW 15 25,724,011 (GRCm39) missense probably damaging 1.00
R7266:Myo10 UTSW 15 25,783,067 (GRCm39) missense probably damaging 1.00
R7380:Myo10 UTSW 15 25,779,706 (GRCm39) missense probably benign 0.01
R7460:Myo10 UTSW 15 25,807,913 (GRCm39) missense probably damaging 1.00
R7614:Myo10 UTSW 15 25,701,709 (GRCm39) missense probably benign 0.00
R7618:Myo10 UTSW 15 25,726,561 (GRCm39) nonsense probably null
R7717:Myo10 UTSW 15 25,732,056 (GRCm39) missense probably benign 0.01
R7811:Myo10 UTSW 15 25,804,610 (GRCm39) missense probably damaging 1.00
R7862:Myo10 UTSW 15 25,666,522 (GRCm39) missense probably damaging 1.00
R8232:Myo10 UTSW 15 25,804,400 (GRCm39) missense possibly damaging 0.89
R8264:Myo10 UTSW 15 25,800,195 (GRCm39) missense probably damaging 0.99
R8377:Myo10 UTSW 15 25,804,481 (GRCm39) missense possibly damaging 0.94
R8385:Myo10 UTSW 15 25,804,484 (GRCm39) missense probably damaging 1.00
R8426:Myo10 UTSW 15 25,799,576 (GRCm39) missense probably damaging 0.99
R8439:Myo10 UTSW 15 25,725,158 (GRCm39) missense probably benign 0.00
R8696:Myo10 UTSW 15 25,799,572 (GRCm39) missense probably damaging 1.00
R8775:Myo10 UTSW 15 25,800,145 (GRCm39) missense probably damaging 0.97
R8775-TAIL:Myo10 UTSW 15 25,800,145 (GRCm39) missense probably damaging 0.97
R8970:Myo10 UTSW 15 25,803,467 (GRCm39) missense possibly damaging 0.82
R9024:Myo10 UTSW 15 25,793,295 (GRCm39) missense possibly damaging 0.53
R9196:Myo10 UTSW 15 25,805,716 (GRCm39) missense probably damaging 0.96
R9224:Myo10 UTSW 15 25,808,081 (GRCm39) missense probably benign 0.33
R9308:Myo10 UTSW 15 25,781,862 (GRCm39) missense probably damaging 0.99
R9358:Myo10 UTSW 15 25,781,520 (GRCm39) missense possibly damaging 0.69
R9606:Myo10 UTSW 15 25,776,401 (GRCm39) frame shift probably null
R9722:Myo10 UTSW 15 25,801,227 (GRCm39) missense probably damaging 1.00
RF013:Myo10 UTSW 15 25,799,565 (GRCm39) missense probably damaging 0.99
Z1177:Myo10 UTSW 15 25,799,640 (GRCm39) critical splice donor site probably null
Z1177:Myo10 UTSW 15 25,781,487 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGAACTGTTCAACCTATTGTC -3'
(R):5'- TGGAGTTACAGGTATACATCACCATG -3'

Sequencing Primer
(F):5'- CCTATTGTCATGAAAGAGTTGAGAGC -3'
(R):5'- CAGGTATACATCACCATGCCTGG -3'
Posted On 2019-12-03