Incidental Mutation 'R7830:Golgb1'
ID 602400
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Name golgi autoantigen, golgin subfamily b, macrogolgin 1
Synonyms Giantin, C130074L01Rik, F730017E11Rik, Gm6840, 6330407A06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_030035.1

Is this an essential gene? Probably essential (E-score: 0.890) question?
Stock # R7830 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 36875140-36933085 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 36898721 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 330 (Y330D)
Ref Sequence ENSEMBL: ENSMUSP00000110460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039855] [ENSMUST00000114812]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000039855
AA Change: Y371D

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045239
Gene: ENSMUSG00000034243
AA Change: Y371D

DomainStartEndE-ValueType
internal_repeat_2 24 61 7.47e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
coiled coil region 130 219 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
internal_repeat_3 519 558 7.47e-6 PROSPERO
coiled coil region 563 594 N/A INTRINSIC
internal_repeat_4 627 661 3.38e-5 PROSPERO
coiled coil region 679 1121 N/A INTRINSIC
coiled coil region 1153 1240 N/A INTRINSIC
internal_repeat_4 1253 1288 3.38e-5 PROSPERO
low complexity region 1300 1314 N/A INTRINSIC
internal_repeat_1 1321 1352 3.51e-6 PROSPERO
low complexity region 1357 1369 N/A INTRINSIC
coiled coil region 1402 1755 N/A INTRINSIC
internal_repeat_2 1760 1798 7.47e-6 PROSPERO
internal_repeat_3 1761 1804 7.47e-6 PROSPERO
coiled coil region 1818 2034 N/A INTRINSIC
low complexity region 2291 2306 N/A INTRINSIC
internal_repeat_1 2351 2382 3.51e-6 PROSPERO
low complexity region 2400 2418 N/A INTRINSIC
low complexity region 2538 2549 N/A INTRINSIC
coiled coil region 2775 2827 N/A INTRINSIC
coiled coil region 2854 2943 N/A INTRINSIC
low complexity region 2964 2976 N/A INTRINSIC
coiled coil region 3007 3057 N/A INTRINSIC
coiled coil region 3117 3163 N/A INTRINSIC
transmembrane domain 3215 3237 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114812
AA Change: Y330D

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243
AA Change: Y330D

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,168,871 N24S probably benign Het
4932438A13Rik CCAGATTCATGTAGCA CCA 3: 36,964,932 probably null Het
Adat3 T C 10: 80,606,820 L164P probably damaging Het
Aldh16a1 A T 7: 45,146,225 L388Q probably damaging Het
Angpt1 T C 15: 42,676,268 N65S probably damaging Het
Ankrd54 G A 15: 79,054,050 T287I probably damaging Het
Cc2d2b T A 19: 40,765,357 V108E possibly damaging Het
Cntnap5c A T 17: 58,162,250 D609V probably damaging Het
Col6a4 G T 9: 106,075,390 D436E probably damaging Het
Cul9 A T 17: 46,540,311 D394E probably benign Het
Cyfip1 A G 7: 55,873,462 E75G probably damaging Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Eif2ak2 C T 17: 78,866,403 G249S probably damaging Het
Erich4 A T 7: 25,615,724 M42K probably benign Het
Fig4 A C 10: 41,256,466 V448G probably benign Het
Gas1 T C 13: 60,176,034 D303G probably damaging Het
Gm609 A T 16: 45,442,554 I187N probably damaging Het
Gpr146 C T 5: 139,392,602 A53V probably benign Het
Klk1b27 A C 7: 44,055,726 M106L probably benign Het
Lipc T C 9: 70,812,901 T190A probably damaging Het
Lrrc4b A G 7: 44,461,807 I368V possibly damaging Het
Mmp10 A T 9: 7,507,283 Q368L probably benign Het
Myo10 T A 15: 25,737,971 Y501* probably null Het
Neb T A 2: 52,165,189 H6445L probably benign Het
Numa1 T A 7: 101,999,285 M741K probably benign Het
Nxn T A 11: 76,273,993 I231F probably damaging Het
Olfr1471 T C 19: 13,445,621 L203S probably benign Het
Olfr341 A G 2: 36,479,380 L250P probably damaging Het
Osbp2 A G 11: 3,863,414 S152P probably benign Het
P3h4 T C 11: 100,414,043 T173A probably damaging Het
Pcdh15 C A 10: 74,385,901 R678S probably damaging Het
Pcdhb6 C A 18: 37,336,312 T762K probably benign Het
Pnrc1 G A 4: 33,248,057 P114L probably damaging Het
Ppp3ca T A 3: 136,868,720 S126R probably damaging Het
Prl3d2 C T 13: 27,126,017 T155I probably benign Het
Prune2 C A 19: 17,122,674 N1847K probably benign Het
Psg21 A T 7: 18,647,298 V440E probably damaging Het
Rag1 A G 2: 101,642,059 S913P probably damaging Het
Ros1 T A 10: 52,154,934 H525L probably damaging Het
Scarb1 T C 5: 125,287,383 Y94C probably damaging Het
Serpinb6a T G 13: 33,930,047 D120A probably benign Het
Sik3 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 9: 46,212,057 probably benign Het
Slc39a14 T C 14: 70,310,117 D299G probably benign Het
Sox1 G A 8: 12,396,955 A199T probably damaging Het
Strc T A 2: 121,375,049 I867F probably damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Usf3 C T 16: 44,219,779 Q1541* probably null Het
Wrn G A 8: 33,269,054 L716F probably damaging Het
Zfp141 G A 7: 42,475,188 T620I probably benign Het
Zfp354b A T 11: 50,923,309 I263K probably benign Het
Zfp804b T A 5: 6,771,124 E646D probably benign Het
Zfp970 G T 2: 177,475,545 C304F probably damaging Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36931564 missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36915502 nonsense probably null
IGL01965:Golgb1 APN 16 36917920 missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36916304 missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36913128 missense probably benign 0.25
IGL02383:Golgb1 APN 16 36886200 missense probably benign 0.01
IGL02444:Golgb1 APN 16 36907816 splice site probably benign
IGL02635:Golgb1 APN 16 36915013 missense probably benign 0.00
IGL02655:Golgb1 APN 16 36918080 missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36925849 missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36916210 missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36912080 missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36925810 missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36912866 missense probably benign 0.11
IGL03109:Golgb1 APN 16 36915611 missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36913453 nonsense probably null
I2288:Golgb1 UTSW 16 36898542 missense probably benign 0.00
I2289:Golgb1 UTSW 16 36898542 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0080:Golgb1 UTSW 16 36898611 missense probably damaging 1.00
R0102:Golgb1 UTSW 16 36875468 intron probably benign
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0276:Golgb1 UTSW 16 36913876 missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36875579 intron probably benign
R0469:Golgb1 UTSW 16 36931635 missense probably benign 0.41
R0522:Golgb1 UTSW 16 36915205 frame shift probably null
R0575:Golgb1 UTSW 16 36918809 missense probably benign
R0600:Golgb1 UTSW 16 36916271 missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36916330 nonsense probably null
R0711:Golgb1 UTSW 16 36918790 missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36898790 missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36912277 missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36916126 missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36915205 frame shift probably null
R1315:Golgb1 UTSW 16 36914900 missense probably benign 0.40
R1429:Golgb1 UTSW 16 36900563 missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36919643 missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36898788 missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36926101 missense probably benign 0.25
R1659:Golgb1 UTSW 16 36887617 missense probably benign 0.01
R1769:Golgb1 UTSW 16 36916001 missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36914664 missense probably benign
R2212:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36893360 missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36898559 missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36912008 missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36918466 missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36915151 missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36894849 missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36918912 missense probably benign 0.00
R3847:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3850:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3936:Golgb1 UTSW 16 36914056 nonsense probably null
R3975:Golgb1 UTSW 16 36918571 missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36915344 missense probably benign 0.00
R4369:Golgb1 UTSW 16 36916907 missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36929263 missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36887618 missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36891419 missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36913115 missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36891407 missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36893386 missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36916118 missense probably benign 0.05
R5121:Golgb1 UTSW 16 36919258 missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36891457 missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36898689 missense probably benign 0.09
R5185:Golgb1 UTSW 16 36875141 unclassified probably benign
R5188:Golgb1 UTSW 16 36918465 missense probably benign 0.13
R5260:Golgb1 UTSW 16 36913141 missense probably benign 0.00
R5297:Golgb1 UTSW 16 36875616 intron probably benign
R5386:Golgb1 UTSW 16 36912315 nonsense probably null
R5438:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5439:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5494:Golgb1 UTSW 16 36928683 missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36925763 missense probably benign 0.02
R5740:Golgb1 UTSW 16 36919000 missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36926091 splice site silent
R5928:Golgb1 UTSW 16 36911987 missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36914959 missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36914671 missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36912865 missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36893395 missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36915622 missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36913978 missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36918197 nonsense probably null
R6700:Golgb1 UTSW 16 36875584 intron probably benign
R6870:Golgb1 UTSW 16 36918203 missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36913990 missense probably benign
R6944:Golgb1 UTSW 16 36912113 missense probably benign
R7108:Golgb1 UTSW 16 36913721 missense probably benign 0.01
R7124:Golgb1 UTSW 16 36913673 missense probably benign 0.01
R7125:Golgb1 UTSW 16 36917963 missense possibly damaging 0.85
R7187:Golgb1 UTSW 16 36916150 missense probably benign 0.43
R7205:Golgb1 UTSW 16 36875301 missense unknown
R7206:Golgb1 UTSW 16 36913749 missense probably benign 0.41
R7233:Golgb1 UTSW 16 36914758 missense possibly damaging 0.91
R7320:Golgb1 UTSW 16 36915951 nonsense probably null
R7367:Golgb1 UTSW 16 36898546 missense probably benign 0.00
R7408:Golgb1 UTSW 16 36898547 missense probably damaging 0.98
R7419:Golgb1 UTSW 16 36912919 missense possibly damaging 0.95
R7556:Golgb1 UTSW 16 36915793 missense probably benign 0.03
R7599:Golgb1 UTSW 16 36875396 missense unknown
R7673:Golgb1 UTSW 16 36913669 missense probably benign 0.05
R7789:Golgb1 UTSW 16 36875399 missense unknown
R7792:Golgb1 UTSW 16 36918730 missense probably benign 0.43
R7847:Golgb1 UTSW 16 36931920 missense probably damaging 1.00
R7905:Golgb1 UTSW 16 36913685 missense probably benign
R7944:Golgb1 UTSW 16 36914104 missense probably benign 0.02
R7945:Golgb1 UTSW 16 36914104 missense probably benign 0.02
R7950:Golgb1 UTSW 16 36915424 missense probably benign 0.13
R8040:Golgb1 UTSW 16 36913479 missense possibly damaging 0.85
R8077:Golgb1 UTSW 16 36918633 missense probably damaging 0.99
R8181:Golgb1 UTSW 16 36916830 missense probably damaging 1.00
R8370:Golgb1 UTSW 16 36912317 missense probably benign 0.00
R8684:Golgb1 UTSW 16 36914402 missense possibly damaging 0.92
R8725:Golgb1 UTSW 16 36919201 missense probably damaging 1.00
R8727:Golgb1 UTSW 16 36919201 missense probably damaging 1.00
R8738:Golgb1 UTSW 16 36916313 missense probably damaging 1.00
R8785:Golgb1 UTSW 16 36919744 missense probably damaging 0.99
R8824:Golgb1 UTSW 16 36915689 missense probably benign
R8825:Golgb1 UTSW 16 36919447 missense probably benign 0.00
R8940:Golgb1 UTSW 16 36916397 missense probably damaging 1.00
R8962:Golgb1 UTSW 16 36913616 missense probably damaging 1.00
R9245:Golgb1 UTSW 16 36918819 nonsense probably null
R9365:Golgb1 UTSW 16 36915762 missense probably damaging 1.00
R9612:Golgb1 UTSW 16 36919605 missense probably benign 0.41
R9620:Golgb1 UTSW 16 36919449 missense probably benign
R9691:Golgb1 UTSW 16 36898634 missense probably damaging 1.00
R9747:Golgb1 UTSW 16 36893407 missense probably damaging 1.00
V1662:Golgb1 UTSW 16 36898542 missense probably benign 0.00
X0067:Golgb1 UTSW 16 36914303 nonsense probably null
Z1088:Golgb1 UTSW 16 36919742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTTGGAGGCTGAACATAATAC -3'
(R):5'- CAATCCACTAAGGGGCTAGAGG -3'

Sequencing Primer
(F):5'- TGGAGGCTGAACATAATACTTTAAAG -3'
(R):5'- TGGCACACACTGACCTTC -3'
Posted On 2019-12-03