Incidental Mutation 'R7828:Fcamr'
ID602412
Institutional Source Beutler Lab
Gene Symbol Fcamr
Ensembl Gene ENSMUSG00000026415
Gene NameFc receptor, IgA, IgM, high affinity
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7828 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location130800902-130814740 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 130811706 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 248 (A248S)
Ref Sequence ENSEMBL: ENSMUSP00000108096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027670] [ENSMUST00000112477]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027670
AA Change: A192S

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027670
Gene: ENSMUSG00000026415
AA Change: A192S

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 87 191 1.19e-5 SMART
low complexity region 208 220 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
transmembrane domain 456 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112477
AA Change: A248S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108096
Gene: ENSMUSG00000026415
AA Change: A248S

DomainStartEndE-ValueType
low complexity region 80 87 N/A INTRINSIC
IG 143 247 1.19e-5 SMART
low complexity region 264 276 N/A INTRINSIC
low complexity region 297 309 N/A INTRINSIC
transmembrane domain 512 531 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Homozygous null mice have enhanced germinal center formation, affinity maturation and memory induction of IgG3 producing B cells after immunization with T cell-independent antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,528,275 T869A probably benign Het
Aqr T A 2: 114,149,016 I313F probably damaging Het
Arid1b C A 17: 5,097,668 P615Q probably damaging Het
Asb16 C A 11: 102,277,927 Q410K probably benign Het
Ash2l T C 8: 25,823,186 E335G possibly damaging Het
AU041133 C T 10: 82,151,220 H236Y probably damaging Het
Bhmt T A 13: 93,617,648 Y351F possibly damaging Het
Birc6 T C 17: 74,579,506 S610P probably damaging Het
Cab39l T C 14: 59,499,710 probably null Het
Cdc7 A T 5: 106,972,950 Q146L possibly damaging Het
Cdk18 T C 1: 132,116,904 H328R possibly damaging Het
Cdsn T C 17: 35,554,981 S136P unknown Het
Ces3b T A 8: 105,086,596 L203Q probably damaging Het
Cgn A G 3: 94,769,179 V840A probably damaging Het
Ctse T C 1: 131,662,753 L71P probably damaging Het
Ears2 G T 7: 122,048,340 S240R probably benign Het
Edem3 A G 1: 151,811,635 I756V possibly damaging Het
Epas1 T C 17: 86,827,699 Y587H probably benign Het
Gm14496 G A 2: 181,991,378 W51* probably null Het
Hfm1 A T 5: 106,881,791 probably null Het
Hhip T C 8: 79,998,208 I312V probably benign Het
Hmcn2 C A 2: 31,405,875 N2658K possibly damaging Het
Iars T A 13: 49,725,272 M948K probably benign Het
Il27ra A G 8: 84,031,558 L521S probably damaging Het
Itpr1 A G 6: 108,482,931 D2062G probably damaging Het
Jag2 G T 12: 112,913,180 R784S probably benign Het
Maea T A 5: 33,360,378 D87E probably benign Het
Man2a2 A G 7: 80,366,926 I380T probably damaging Het
Mprip G T 11: 59,737,089 G253W probably damaging Het
Naglu G A 11: 101,076,610 R462H probably damaging Het
Nrxn1 T A 17: 90,059,551 I342F probably damaging Het
Olfr1419 A T 19: 11,870,805 M137K probably damaging Het
Olfr1467 G A 19: 13,365,146 V173I probably benign Het
Olfr821 A G 10: 130,033,887 D87G probably damaging Het
Olfr834 T C 9: 18,988,920 S311P probably benign Het
Oosp1 C A 19: 11,691,005 V5L probably benign Het
Pbrm1 T C 14: 31,030,891 M95T probably damaging Het
Pcdh17 C G 14: 84,532,985 R968G probably damaging Het
Pcdhb7 T G 18: 37,343,862 S684A probably damaging Het
Polr1b T G 2: 129,105,280 I175R probably damaging Het
Ppp3ca A G 3: 136,797,774 D36G probably damaging Het
Prr14l G A 5: 32,844,391 probably benign Het
Rcn2 A T 9: 56,052,982 I178F probably benign Het
Sbspon T G 1: 15,860,319 K148Q probably damaging Het
Scn3a A T 2: 65,508,574 V587E probably damaging Het
Setd7 T A 3: 51,536,657 probably null Het
Sh2d5 C A 4: 138,256,797 P85T probably benign Het
Slc12a1 T A 2: 125,166,682 V204D possibly damaging Het
Slc2a8 G A 2: 32,980,068 R154* probably null Het
Slc36a3 C T 11: 55,151,198 G42S probably benign Het
Spink5 A G 18: 44,010,229 K751R probably benign Het
Sult2a5 T A 7: 13,628,843 probably null Het
Thoc5 T C 11: 4,902,306 probably benign Het
Ttn A G 2: 76,975,037 S153P probably damaging Het
Ubap2 A T 4: 41,221,615 L228Q probably benign Het
Upk3b G A 5: 136,040,139 G121S possibly damaging Het
Usp1 T A 4: 98,932,307 S456R probably damaging Het
Usp28 A T 9: 49,003,902 N126Y possibly damaging Het
Wdfy4 C T 14: 32,988,921 V2411M possibly damaging Het
Zfp595 C T 13: 67,317,705 E165K probably damaging Het
Other mutations in Fcamr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Fcamr APN 1 130813214 missense probably benign 0.01
IGL02880:Fcamr APN 1 130813334 missense probably benign 0.00
IGL03199:Fcamr APN 1 130812918 missense probably damaging 1.00
IGL03392:Fcamr APN 1 130800948 utr 5 prime probably benign
IGL03398:Fcamr APN 1 130803248 missense probably damaging 0.97
R1101:Fcamr UTSW 1 130814486 splice site probably null
R1312:Fcamr UTSW 1 130811487 missense probably damaging 1.00
R1351:Fcamr UTSW 1 130813020 missense possibly damaging 0.83
R1387:Fcamr UTSW 1 130804642 missense possibly damaging 0.85
R1475:Fcamr UTSW 1 130814484 splice site probably null
R1728:Fcamr UTSW 1 130804569 missense probably benign 0.06
R1728:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1728:Fcamr UTSW 1 130811580 missense probably benign
R1728:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1728:Fcamr UTSW 1 130812692 missense probably benign
R1728:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1728:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1728:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1728:Fcamr UTSW 1 130814597 missense probably benign
R1729:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1729:Fcamr UTSW 1 130811580 missense probably benign
R1729:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1729:Fcamr UTSW 1 130812692 missense probably benign
R1729:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1729:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1729:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1729:Fcamr UTSW 1 130814597 missense probably benign
R1730:Fcamr UTSW 1 130811580 missense probably benign
R1730:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1730:Fcamr UTSW 1 130812692 missense probably benign
R1730:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1730:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1730:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1730:Fcamr UTSW 1 130814597 missense probably benign
R1739:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1739:Fcamr UTSW 1 130811580 missense probably benign
R1739:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1739:Fcamr UTSW 1 130812692 missense probably benign
R1739:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1739:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1739:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1739:Fcamr UTSW 1 130814597 missense probably benign
R1762:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1762:Fcamr UTSW 1 130811580 missense probably benign
R1762:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1762:Fcamr UTSW 1 130812692 missense probably benign
R1762:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1762:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1762:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1762:Fcamr UTSW 1 130814597 missense probably benign
R1783:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1783:Fcamr UTSW 1 130811580 missense probably benign
R1783:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1783:Fcamr UTSW 1 130812692 missense probably benign
R1783:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1783:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1783:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1783:Fcamr UTSW 1 130814597 missense probably benign
R1784:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1784:Fcamr UTSW 1 130811580 missense probably benign
R1784:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1784:Fcamr UTSW 1 130812692 missense probably benign
R1784:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1784:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1784:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1784:Fcamr UTSW 1 130814597 missense probably benign
R1785:Fcamr UTSW 1 130804569 missense probably benign 0.06
R1785:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1785:Fcamr UTSW 1 130811580 missense probably benign
R1785:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1785:Fcamr UTSW 1 130812692 missense probably benign
R1785:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1785:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1785:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1785:Fcamr UTSW 1 130814597 missense probably benign
R1793:Fcamr UTSW 1 130811547 missense probably benign 0.03
R2085:Fcamr UTSW 1 130811598 missense probably damaging 1.00
R3937:Fcamr UTSW 1 130804576 missense probably damaging 0.97
R4529:Fcamr UTSW 1 130804576 missense probably damaging 0.99
R4624:Fcamr UTSW 1 130803262 missense probably damaging 0.99
R4822:Fcamr UTSW 1 130812686 missense possibly damaging 0.82
R5055:Fcamr UTSW 1 130811437 missense probably damaging 1.00
R5514:Fcamr UTSW 1 130814056 missense probably damaging 1.00
R5807:Fcamr UTSW 1 130811526 missense probably damaging 1.00
R6077:Fcamr UTSW 1 130812926 missense probably damaging 1.00
R6200:Fcamr UTSW 1 130803190 missense probably benign 0.16
R6653:Fcamr UTSW 1 130813202 missense possibly damaging 0.89
R7081:Fcamr UTSW 1 130813212 missense probably damaging 1.00
R7362:Fcamr UTSW 1 130814023 missense possibly damaging 0.52
R7861:Fcamr UTSW 1 130814638 missense probably benign
X0012:Fcamr UTSW 1 130812734 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGGATCTGTCACACTGTCGTG -3'
(R):5'- GCTATCTGCCTTCTTGAAGATGAC -3'

Sequencing Primer
(F):5'- ACTGTCGTGTCCACCAAC -3'
(R):5'- AGTTTTCCTCCTGGAGTC -3'
Posted On2019-12-03