Incidental Mutation 'R7828:Slc12a1'
ID602421
Institutional Source Beutler Lab
Gene Symbol Slc12a1
Ensembl Gene ENSMUSG00000027202
Gene Namesolute carrier family 12, member 1
Synonymsurehr3, mBSC1, Nkcc2, D630042G03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R7828 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location125152505-125230002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125166682 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 204 (V204D)
Ref Sequence ENSEMBL: ENSMUSP00000106121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028630] [ENSMUST00000110494] [ENSMUST00000110495]
Predicted Effect probably benign
Transcript: ENSMUST00000028630
SMART Domains Protein: ENSMUSP00000028630
Gene: ENSMUSG00000027202

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 82 152 5.3e-22 PFAM
Pfam:AA_permease 173 677 2.3e-152 PFAM
Pfam:AA_permease_2 177 636 2.6e-24 PFAM
coiled coil region 815 843 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110494
SMART Domains Protein: ENSMUSP00000106120
Gene: ENSMUSG00000027202

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 83 148 3.3e-26 PFAM
Pfam:AA_permease 173 677 2.2e-151 PFAM
Pfam:SLC12 685 1090 1.5e-153 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110495
AA Change: V204D

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106121
Gene: ENSMUSG00000027202
AA Change: V204D

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 83 148 3.3e-26 PFAM
Pfam:AA_permease 173 677 1.6e-151 PFAM
Pfam:SLC12 685 1090 1.5e-153 PFAM
Meta Mutation Damage Score 0.3612 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kidney-specific sodium-potassium-chloride cotransporter that is expressed on the luminal membrane of renal epithelial cells of the thick ascending limb of Henle's loop and the macula densa. It plays a key role in concentrating urine and accounts for most of the NaCl resorption. It is sensitive to such diuretics as furosemide and bumetanide. Some Bartter-like syndromes result from defects in this gene. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity in humans has not been experimentally proven.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene do not survive to weaning and suffer from various metabolic abnormalities related to kidney function. Mice homozygous for an ENU-induced allele exhibit kidney disease, impaired urinary excretion of metabolism products, polyuria, and kidney alterations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,528,275 T869A probably benign Het
Aqr T A 2: 114,149,016 I313F probably damaging Het
Arid1b C A 17: 5,097,668 P615Q probably damaging Het
Asb16 C A 11: 102,277,927 Q410K probably benign Het
Ash2l T C 8: 25,823,186 E335G possibly damaging Het
AU041133 C T 10: 82,151,220 H236Y probably damaging Het
Bhmt T A 13: 93,617,648 Y351F possibly damaging Het
Birc6 T C 17: 74,579,506 S610P probably damaging Het
Cab39l T C 14: 59,499,710 probably null Het
Cdc7 A T 5: 106,972,950 Q146L possibly damaging Het
Cdk18 T C 1: 132,116,904 H328R possibly damaging Het
Cdsn T C 17: 35,554,981 S136P unknown Het
Ces3b T A 8: 105,086,596 L203Q probably damaging Het
Cgn A G 3: 94,769,179 V840A probably damaging Het
Ctse T C 1: 131,662,753 L71P probably damaging Het
Ears2 G T 7: 122,048,340 S240R probably benign Het
Edem3 A G 1: 151,811,635 I756V possibly damaging Het
Epas1 T C 17: 86,827,699 Y587H probably benign Het
Fcamr G T 1: 130,811,706 A248S probably damaging Het
Gm14496 G A 2: 181,991,378 W51* probably null Het
Hfm1 A T 5: 106,881,791 probably null Het
Hhip T C 8: 79,998,208 I312V probably benign Het
Hmcn2 C A 2: 31,405,875 N2658K possibly damaging Het
Iars T A 13: 49,725,272 M948K probably benign Het
Il27ra A G 8: 84,031,558 L521S probably damaging Het
Itpr1 A G 6: 108,482,931 D2062G probably damaging Het
Jag2 G T 12: 112,913,180 R784S probably benign Het
Maea T A 5: 33,360,378 D87E probably benign Het
Man2a2 A G 7: 80,366,926 I380T probably damaging Het
Mprip G T 11: 59,737,089 G253W probably damaging Het
Naglu G A 11: 101,076,610 R462H probably damaging Het
Nrxn1 T A 17: 90,059,551 I342F probably damaging Het
Olfr1419 A T 19: 11,870,805 M137K probably damaging Het
Olfr1467 G A 19: 13,365,146 V173I probably benign Het
Olfr821 A G 10: 130,033,887 D87G probably damaging Het
Olfr834 T C 9: 18,988,920 S311P probably benign Het
Oosp1 C A 19: 11,691,005 V5L probably benign Het
Pbrm1 T C 14: 31,030,891 M95T probably damaging Het
Pcdh17 C G 14: 84,532,985 R968G probably damaging Het
Pcdhb7 T G 18: 37,343,862 S684A probably damaging Het
Polr1b T G 2: 129,105,280 I175R probably damaging Het
Ppp3ca A G 3: 136,797,774 D36G probably damaging Het
Prr14l G A 5: 32,844,391 probably benign Het
Rcn2 A T 9: 56,052,982 I178F probably benign Het
Sbspon T G 1: 15,860,319 K148Q probably damaging Het
Scn3a A T 2: 65,508,574 V587E probably damaging Het
Setd7 T A 3: 51,536,657 probably null Het
Sh2d5 C A 4: 138,256,797 P85T probably benign Het
Slc2a8 G A 2: 32,980,068 R154* probably null Het
Slc36a3 C T 11: 55,151,198 G42S probably benign Het
Spink5 A G 18: 44,010,229 K751R probably benign Het
Sult2a5 T A 7: 13,628,843 probably null Het
Thoc5 T C 11: 4,902,306 probably benign Het
Ttn A G 2: 76,975,037 S153P probably damaging Het
Ubap2 A T 4: 41,221,615 L228Q probably benign Het
Upk3b G A 5: 136,040,139 G121S possibly damaging Het
Usp1 T A 4: 98,932,307 S456R probably damaging Het
Usp28 A T 9: 49,003,902 N126Y possibly damaging Het
Wdfy4 C T 14: 32,988,921 V2411M possibly damaging Het
Zfp595 C T 13: 67,317,705 E165K probably damaging Het
Other mutations in Slc12a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Slc12a1 APN 2 125188194 missense probably damaging 1.00
IGL00845:Slc12a1 APN 2 125188238 missense probably damaging 1.00
IGL01348:Slc12a1 APN 2 125194131 missense probably damaging 1.00
IGL01534:Slc12a1 APN 2 125217910 missense probably damaging 1.00
IGL01677:Slc12a1 APN 2 125178149 splice site probably benign
IGL02150:Slc12a1 APN 2 125184815 missense probably damaging 1.00
IGL02220:Slc12a1 APN 2 125188270 critical splice donor site probably null
IGL02568:Slc12a1 APN 2 125184728 missense probably damaging 1.00
IGL02602:Slc12a1 APN 2 125154242 missense probably damaging 1.00
IGL02625:Slc12a1 APN 2 125170691 missense probably damaging 1.00
IGL02635:Slc12a1 APN 2 125225978 missense probably benign
IGL02672:Slc12a1 APN 2 125170676 missense probably damaging 1.00
IGL02718:Slc12a1 APN 2 125161079 nonsense probably null
IGL03191:Slc12a1 APN 2 125206089 missense possibly damaging 0.87
FR4449:Slc12a1 UTSW 2 125154216 small insertion probably benign
FR4548:Slc12a1 UTSW 2 125154214 small insertion probably benign
FR4737:Slc12a1 UTSW 2 125154214 small insertion probably benign
PIT4431001:Slc12a1 UTSW 2 125190204 missense possibly damaging 0.78
R0033:Slc12a1 UTSW 2 125214009 missense probably benign
R0127:Slc12a1 UTSW 2 125219762 missense probably damaging 1.00
R0312:Slc12a1 UTSW 2 125226028 missense probably damaging 0.98
R0373:Slc12a1 UTSW 2 125226031 missense probably damaging 1.00
R0692:Slc12a1 UTSW 2 125194162 nonsense probably null
R1194:Slc12a1 UTSW 2 125184767 missense probably benign 0.00
R1264:Slc12a1 UTSW 2 125218238 missense possibly damaging 0.56
R1529:Slc12a1 UTSW 2 125190295 missense probably damaging 1.00
R1543:Slc12a1 UTSW 2 125184857 missense possibly damaging 0.93
R1940:Slc12a1 UTSW 2 125194193 missense probably benign 0.05
R2109:Slc12a1 UTSW 2 125173699 missense probably damaging 1.00
R2167:Slc12a1 UTSW 2 125173681 missense probably damaging 1.00
R3409:Slc12a1 UTSW 2 125154151 missense probably benign 0.00
R3902:Slc12a1 UTSW 2 125188193 missense probably damaging 1.00
R4079:Slc12a1 UTSW 2 125200623 missense possibly damaging 0.86
R4502:Slc12a1 UTSW 2 125226044 missense probably damaging 1.00
R4557:Slc12a1 UTSW 2 125186641 missense probably damaging 1.00
R4719:Slc12a1 UTSW 2 125153993 missense possibly damaging 0.82
R4782:Slc12a1 UTSW 2 125161079 nonsense probably null
R4845:Slc12a1 UTSW 2 125188226 missense probably damaging 1.00
R4913:Slc12a1 UTSW 2 125228750 missense probably damaging 0.96
R5024:Slc12a1 UTSW 2 125166137 missense probably benign 0.00
R5112:Slc12a1 UTSW 2 125218224 missense possibly damaging 0.63
R5334:Slc12a1 UTSW 2 125217889 missense probably damaging 1.00
R5470:Slc12a1 UTSW 2 125170714 missense probably damaging 1.00
R6057:Slc12a1 UTSW 2 125190213 missense probably damaging 1.00
R6604:Slc12a1 UTSW 2 125184815 missense probably damaging 1.00
R6941:Slc12a1 UTSW 2 125214079 missense possibly damaging 0.85
R6944:Slc12a1 UTSW 2 125160534 missense probably damaging 0.97
R7049:Slc12a1 UTSW 2 125171257 missense probably benign 0.04
R7204:Slc12a1 UTSW 2 125200622 missense possibly damaging 0.93
R7427:Slc12a1 UTSW 2 125214132 missense probably benign
R7428:Slc12a1 UTSW 2 125214132 missense probably benign
R7432:Slc12a1 UTSW 2 125206040 missense probably benign 0.36
R7470:Slc12a1 UTSW 2 125217895 nonsense probably null
R7862:Slc12a1 UTSW 2 125161094 missense probably damaging 0.99
R7923:Slc12a1 UTSW 2 125214092 missense possibly damaging 0.75
R8020:Slc12a1 UTSW 2 125178102 missense possibly damaging 0.78
R8071:Slc12a1 UTSW 2 125186314 missense probably damaging 1.00
R8272:Slc12a1 UTSW 2 125228816 missense probably damaging 1.00
R8302:Slc12a1 UTSW 2 125190289 missense probably damaging 0.99
RF032:Slc12a1 UTSW 2 125154210 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GCTGGCGTTTATCAGGAAAC -3'
(R):5'- CTTGGGAGCCAGTTAGCATC -3'

Sequencing Primer
(F):5'- ATCAGGAAACGACTCCTCTGTGTG -3'
(R):5'- TGGGAGCCAGTTAGCATCTTCAC -3'
Posted On2019-12-03