Incidental Mutation 'R7828:Cgn'
ID602425
Institutional Source Beutler Lab
Gene Symbol Cgn
Ensembl Gene ENSMUSG00000068876
Gene Namecingulin
Synonyms6330408J11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7828 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location94760069-94786492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94769179 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 840 (V840A)
Ref Sequence ENSEMBL: ENSMUSP00000102894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107272] [ENSMUST00000107273]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107272
AA Change: V832A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102893
Gene: ENSMUSG00000068876
AA Change: V832A

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
low complexity region 189 198 N/A INTRINSIC
internal_repeat_1 214 229 8.06e-5 PROSPERO
low complexity region 242 260 N/A INTRINSIC
internal_repeat_1 287 302 8.06e-5 PROSPERO
low complexity region 446 462 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
low complexity region 536 549 N/A INTRINSIC
low complexity region 567 592 N/A INTRINSIC
low complexity region 660 676 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
Pfam:Myosin_tail_1 783 1140 3.4e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107273
AA Change: V840A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102894
Gene: ENSMUSG00000068876
AA Change: V840A

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
low complexity region 189 198 N/A INTRINSIC
internal_repeat_1 214 229 8.83e-5 PROSPERO
low complexity region 242 260 N/A INTRINSIC
internal_repeat_1 287 302 8.83e-5 PROSPERO
low complexity region 454 470 N/A INTRINSIC
low complexity region 474 489 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 575 600 N/A INTRINSIC
low complexity region 668 684 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
Pfam:Myosin_tail_1 799 1144 2.2e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to the ulcerogenic action of cysteamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,528,275 T869A probably benign Het
Aqr T A 2: 114,149,016 I313F probably damaging Het
Arid1b C A 17: 5,097,668 P615Q probably damaging Het
Asb16 C A 11: 102,277,927 Q410K probably benign Het
Ash2l T C 8: 25,823,186 E335G possibly damaging Het
AU041133 C T 10: 82,151,220 H236Y probably damaging Het
Bhmt T A 13: 93,617,648 Y351F possibly damaging Het
Birc6 T C 17: 74,579,506 S610P probably damaging Het
Cab39l T C 14: 59,499,710 probably null Het
Cdc7 A T 5: 106,972,950 Q146L possibly damaging Het
Cdk18 T C 1: 132,116,904 H328R possibly damaging Het
Cdsn T C 17: 35,554,981 S136P unknown Het
Ces3b T A 8: 105,086,596 L203Q probably damaging Het
Ctse T C 1: 131,662,753 L71P probably damaging Het
Ears2 G T 7: 122,048,340 S240R probably benign Het
Edem3 A G 1: 151,811,635 I756V possibly damaging Het
Epas1 T C 17: 86,827,699 Y587H probably benign Het
Fcamr G T 1: 130,811,706 A248S probably damaging Het
Gm14496 G A 2: 181,991,378 W51* probably null Het
Hfm1 A T 5: 106,881,791 probably null Het
Hhip T C 8: 79,998,208 I312V probably benign Het
Hmcn2 C A 2: 31,405,875 N2658K possibly damaging Het
Iars T A 13: 49,725,272 M948K probably benign Het
Il27ra A G 8: 84,031,558 L521S probably damaging Het
Itpr1 A G 6: 108,482,931 D2062G probably damaging Het
Jag2 G T 12: 112,913,180 R784S probably benign Het
Maea T A 5: 33,360,378 D87E probably benign Het
Man2a2 A G 7: 80,366,926 I380T probably damaging Het
Mprip G T 11: 59,737,089 G253W probably damaging Het
Naglu G A 11: 101,076,610 R462H probably damaging Het
Nrxn1 T A 17: 90,059,551 I342F probably damaging Het
Olfr1419 A T 19: 11,870,805 M137K probably damaging Het
Olfr1467 G A 19: 13,365,146 V173I probably benign Het
Olfr821 A G 10: 130,033,887 D87G probably damaging Het
Olfr834 T C 9: 18,988,920 S311P probably benign Het
Oosp1 C A 19: 11,691,005 V5L probably benign Het
Pbrm1 T C 14: 31,030,891 M95T probably damaging Het
Pcdh17 C G 14: 84,532,985 R968G probably damaging Het
Pcdhb7 T G 18: 37,343,862 S684A probably damaging Het
Polr1b T G 2: 129,105,280 I175R probably damaging Het
Ppp3ca A G 3: 136,797,774 D36G probably damaging Het
Prr14l G A 5: 32,844,391 probably benign Het
Rcn2 A T 9: 56,052,982 I178F probably benign Het
Sbspon T G 1: 15,860,319 K148Q probably damaging Het
Scn3a A T 2: 65,508,574 V587E probably damaging Het
Setd7 T A 3: 51,536,657 probably null Het
Sh2d5 C A 4: 138,256,797 P85T probably benign Het
Slc12a1 T A 2: 125,166,682 V204D possibly damaging Het
Slc2a8 G A 2: 32,980,068 R154* probably null Het
Slc36a3 C T 11: 55,151,198 G42S probably benign Het
Spink5 A G 18: 44,010,229 K751R probably benign Het
Sult2a5 T A 7: 13,628,843 probably null Het
Thoc5 T C 11: 4,902,306 probably benign Het
Ttn A G 2: 76,975,037 S153P probably damaging Het
Ubap2 A T 4: 41,221,615 L228Q probably benign Het
Upk3b G A 5: 136,040,139 G121S possibly damaging Het
Usp1 T A 4: 98,932,307 S456R probably damaging Het
Usp28 A T 9: 49,003,902 N126Y possibly damaging Het
Wdfy4 C T 14: 32,988,921 V2411M possibly damaging Het
Zfp595 C T 13: 67,317,705 E165K probably damaging Het
Other mutations in Cgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Cgn APN 3 94765548 missense probably benign 0.00
IGL00823:Cgn APN 3 94767209 missense probably damaging 1.00
IGL01349:Cgn APN 3 94767176 nonsense probably null
IGL01433:Cgn APN 3 94779459 missense probably damaging 0.99
IGL01467:Cgn APN 3 94779588 missense probably damaging 1.00
IGL01781:Cgn APN 3 94773205 missense probably benign
IGL01789:Cgn APN 3 94776218 missense possibly damaging 0.63
IGL01879:Cgn APN 3 94774364 nonsense probably null
IGL02805:Cgn APN 3 94774377 missense probably damaging 0.96
IGL02814:Cgn APN 3 94774240 missense probably benign 0.00
IGL02926:Cgn APN 3 94778016 missense probably benign 0.01
IGL03113:Cgn APN 3 94779234 missense probably benign
IGL03340:Cgn APN 3 94778095 intron probably benign
R0054:Cgn UTSW 3 94762592 missense possibly damaging 0.95
R0310:Cgn UTSW 3 94765653 missense possibly damaging 0.88
R0355:Cgn UTSW 3 94774932 missense probably benign
R0615:Cgn UTSW 3 94770714 unclassified probably benign
R0656:Cgn UTSW 3 94774894 unclassified probably benign
R1491:Cgn UTSW 3 94763228 missense probably damaging 1.00
R1509:Cgn UTSW 3 94774258 missense probably benign 0.00
R1794:Cgn UTSW 3 94762557 critical splice donor site probably null
R2113:Cgn UTSW 3 94779806 missense probably damaging 1.00
R3121:Cgn UTSW 3 94778482 splice site probably benign
R4655:Cgn UTSW 3 94779249 nonsense probably null
R4703:Cgn UTSW 3 94776095 utr 3 prime probably benign
R4714:Cgn UTSW 3 94779438 missense probably damaging 1.00
R4715:Cgn UTSW 3 94779438 missense probably damaging 1.00
R4959:Cgn UTSW 3 94778254 missense probably benign 0.06
R4973:Cgn UTSW 3 94778254 missense probably benign 0.06
R4995:Cgn UTSW 3 94779936 missense probably damaging 1.00
R5011:Cgn UTSW 3 94776145 missense probably null 1.00
R5329:Cgn UTSW 3 94779990 start codon destroyed probably null 0.02
R5524:Cgn UTSW 3 94779989 start codon destroyed probably null 0.56
R5695:Cgn UTSW 3 94773635 missense probably benign 0.00
R5839:Cgn UTSW 3 94774393 missense probably damaging 0.99
R5987:Cgn UTSW 3 94779522 missense probably benign 0.00
R6146:Cgn UTSW 3 94767125 missense possibly damaging 0.94
R6311:Cgn UTSW 3 94778176 intron probably benign
R6948:Cgn UTSW 3 94773221 missense probably benign 0.06
R7038:Cgn UTSW 3 94763085 missense possibly damaging 0.80
R7231:Cgn UTSW 3 94773192 missense probably damaging 0.99
R7251:Cgn UTSW 3 94776199 missense possibly damaging 0.82
R7408:Cgn UTSW 3 94763055 nonsense probably null
R7882:Cgn UTSW 3 94762634 missense probably damaging 1.00
R7975:Cgn UTSW 3 94764529 missense probably benign 0.03
R8082:Cgn UTSW 3 94763061 missense probably benign 0.21
R8090:Cgn UTSW 3 94779953 missense probably damaging 1.00
R8128:Cgn UTSW 3 94769381 missense probably benign 0.06
R8275:Cgn UTSW 3 94774953 missense possibly damaging 0.52
Z1176:Cgn UTSW 3 94774273 missense possibly damaging 0.81
Z1176:Cgn UTSW 3 94774346 missense probably damaging 1.00
Z1176:Cgn UTSW 3 94776178 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CCCACATAGACAGATATATCATAAGGA -3'
(R):5'- TTTGAATGCTGCCCGGGAG -3'

Sequencing Primer
(F):5'- CCTTAATTTCAGCACATGGGAGGC -3'
(R):5'- CGGGAGGAGGAGGGGAAC -3'
Posted On2019-12-03