Incidental Mutation 'R7828:Maea'
ID602431
Institutional Source Beutler Lab
Gene Symbol Maea
Ensembl Gene ENSMUSG00000079562
Gene Namemacrophage erythroblast attacher
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7828 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location33335509-33373296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33360378 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 87 (D87E)
Ref Sequence ENSEMBL: ENSMUSP00000144584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114449] [ENSMUST00000200716] [ENSMUST00000200882] [ENSMUST00000202113]
Predicted Effect probably benign
Transcript: ENSMUST00000114449
AA Change: D93E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000110093
Gene: ENSMUSG00000079562
AA Change: D93E

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
LisH 121 153 3.01e-6 SMART
CTLH 159 216 2.16e-16 SMART
CRA 212 306 8.31e-14 SMART
low complexity region 347 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200716
AA Change: D87E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000144584
Gene: ENSMUSG00000079562
AA Change: D87E

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
LisH 115 146 1.1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200882
Predicted Effect probably benign
Transcript: ENSMUST00000202113
AA Change: D45E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000144238
Gene: ENSMUSG00000079562
AA Change: D45E

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that mediates the attachment of erythroblasts to macrophages. This attachment promotes terminal maturation and enucleation of erythroblasts, presumably by suppressing apoptosis. The encoded protein is an integral membrane protein with the N-terminus on the extracellular side and the C-terminus on the cytoplasmic side of the cell. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally displaying reduced fetal size, pallor, reduced numbers of erythroblastic islands, defects in terminal erythroid maturation, and severely impaired terminal differentiation of fetal liver macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,528,275 T869A probably benign Het
Aqr T A 2: 114,149,016 I313F probably damaging Het
Arid1b C A 17: 5,097,668 P615Q probably damaging Het
Asb16 C A 11: 102,277,927 Q410K probably benign Het
Ash2l T C 8: 25,823,186 E335G possibly damaging Het
AU041133 C T 10: 82,151,220 H236Y probably damaging Het
Bhmt T A 13: 93,617,648 Y351F possibly damaging Het
Birc6 T C 17: 74,579,506 S610P probably damaging Het
Cab39l T C 14: 59,499,710 probably null Het
Cdc7 A T 5: 106,972,950 Q146L possibly damaging Het
Cdk18 T C 1: 132,116,904 H328R possibly damaging Het
Cdsn T C 17: 35,554,981 S136P unknown Het
Ces3b T A 8: 105,086,596 L203Q probably damaging Het
Cgn A G 3: 94,769,179 V840A probably damaging Het
Ctse T C 1: 131,662,753 L71P probably damaging Het
Ears2 G T 7: 122,048,340 S240R probably benign Het
Edem3 A G 1: 151,811,635 I756V possibly damaging Het
Epas1 T C 17: 86,827,699 Y587H probably benign Het
Fcamr G T 1: 130,811,706 A248S probably damaging Het
Gm14496 G A 2: 181,991,378 W51* probably null Het
Hfm1 A T 5: 106,881,791 probably null Het
Hhip T C 8: 79,998,208 I312V probably benign Het
Hmcn2 C A 2: 31,405,875 N2658K possibly damaging Het
Iars T A 13: 49,725,272 M948K probably benign Het
Il27ra A G 8: 84,031,558 L521S probably damaging Het
Itpr1 A G 6: 108,482,931 D2062G probably damaging Het
Jag2 G T 12: 112,913,180 R784S probably benign Het
Lyzl4 GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAAGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG 9: 121,583,989 probably null Het
Man2a2 A G 7: 80,366,926 I380T probably damaging Het
Mprip G T 11: 59,737,089 G253W probably damaging Het
Naglu G A 11: 101,076,610 R462H probably damaging Het
Nrxn1 T A 17: 90,059,551 I342F probably damaging Het
Olfr1419 A T 19: 11,870,805 M137K probably damaging Het
Olfr1467 G A 19: 13,365,146 V173I probably benign Het
Olfr821 A G 10: 130,033,887 D87G probably damaging Het
Olfr834 T C 9: 18,988,920 S311P probably benign Het
Oosp1 C A 19: 11,691,005 V5L probably benign Het
Pbrm1 T C 14: 31,030,891 M95T probably damaging Het
Pcdh17 C G 14: 84,532,985 R968G probably damaging Het
Pcdhb7 T G 18: 37,343,862 S684A probably damaging Het
Polr1b T G 2: 129,105,280 I175R probably damaging Het
Ppp3ca A G 3: 136,797,774 D36G probably damaging Het
Prr14l G A 5: 32,844,391 probably benign Het
Rcn2 A T 9: 56,052,982 I178F probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Sbspon T G 1: 15,860,319 K148Q probably damaging Het
Scn3a A T 2: 65,508,574 V587E probably damaging Het
Setd7 T A 3: 51,536,657 probably null Het
Sh2d5 C A 4: 138,256,797 P85T probably benign Het
Slc12a1 T A 2: 125,166,682 V204D possibly damaging Het
Slc2a8 G A 2: 32,980,068 R154* probably null Het
Slc36a3 C T 11: 55,151,198 G42S probably benign Het
Spink5 A G 18: 44,010,229 K751R probably benign Het
Sult2a5 T A 7: 13,628,843 probably null Het
Thoc5 T C 11: 4,902,306 probably benign Het
Ttn A G 2: 76,975,037 S153P probably damaging Het
Ubap2 A T 4: 41,221,615 L228Q probably benign Het
Upk3b G A 5: 136,040,139 G121S possibly damaging Het
Usp1 T A 4: 98,932,307 S456R probably damaging Het
Usp28 A T 9: 49,003,902 N126Y possibly damaging Het
Wdfy4 C T 14: 32,988,921 V2411M possibly damaging Het
Zfp595 C T 13: 67,317,705 E165K probably damaging Het
Other mutations in Maea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Maea APN 5 33372301 missense probably benign 0.01
IGL01540:Maea APN 5 33358566 missense probably benign 0.12
R0365:Maea UTSW 5 33360443 missense probably benign 0.01
R0562:Maea UTSW 5 33372301 missense probably benign 0.01
R1450:Maea UTSW 5 33365800 critical splice donor site probably null
R1576:Maea UTSW 5 33362696 missense probably damaging 1.00
R2177:Maea UTSW 5 33371690 missense probably benign 0.00
R2520:Maea UTSW 5 33358510 missense probably damaging 0.98
R4580:Maea UTSW 5 33360488 missense possibly damaging 0.92
R4710:Maea UTSW 5 33368690 missense probably benign 0.01
R5786:Maea UTSW 5 33368683 missense probably benign 0.01
R6127:Maea UTSW 5 33335518 unclassified probably benign
R7178:Maea UTSW 5 33358510 missense probably damaging 0.98
R7542:Maea UTSW 5 33371663 missense probably damaging 1.00
R7909:Maea UTSW 5 33370474 missense possibly damaging 0.71
R7909:Maea UTSW 5 33370476 nonsense probably null
R7990:Maea UTSW 5 33370474 missense possibly damaging 0.71
R7990:Maea UTSW 5 33370476 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAAAGAAAGGTAGAATCCGATTTC -3'
(R):5'- GAGTTGGAAAAGCCCACCTC -3'

Sequencing Primer
(F):5'- AACGTCCCCAGCTTTTAC -3'
(R):5'- ACCTCGATGCCACTCTGG -3'
Posted On2019-12-03