Incidental Mutation 'R7828:Cdc7'
ID 602433
Institutional Source Beutler Lab
Gene Symbol Cdc7
Ensembl Gene ENSMUSG00000029283
Gene Name cell division cycle 7 (S. cerevisiae)
Synonyms Cdc7, muCdc7, Cdc7l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7828 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 106964322-106984432 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106972950 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 146 (Q146L)
Ref Sequence ENSEMBL: ENSMUSP00000113385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031221] [ENSMUST00000076467] [ENSMUST00000117196] [ENSMUST00000118261] [ENSMUST00000129938]
AlphaFold Q9Z0H0
Predicted Effect possibly damaging
Transcript: ENSMUST00000031221
AA Change: Q146L

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031221
Gene: ENSMUSG00000029283
AA Change: Q146L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 212 1.7e-14 PFAM
Pfam:Pkinase 52 216 4.4e-27 PFAM
Pfam:Pkinase 351 559 1.5e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000076467
AA Change: Q146L

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075792
Gene: ENSMUSG00000029283
AA Change: Q146L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1.7e-14 PFAM
Pfam:Pkinase 52 227 1.1e-25 PFAM
Pfam:Pkinase 314 520 2.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117196
AA Change: Q146L

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112392
Gene: ENSMUSG00000029283
AA Change: Q146L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1e-14 PFAM
Pfam:Pkinase 52 227 6.6e-26 PFAM
Pfam:Pkinase 313 527 4.5e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118261
AA Change: Q146L

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113385
Gene: ENSMUSG00000029283
AA Change: Q146L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1.2e-14 PFAM
Pfam:Pkinase 52 227 7.4e-26 PFAM
Pfam:Pkinase 345 559 5.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129938
AA Change: Q146L

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119612
Gene: ENSMUSG00000029283
AA Change: Q146L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 5.4e-15 PFAM
Pfam:Pkinase 52 227 3.4e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell division cycle protein with kinase activity that is critical for the G1/S transition. The yeast homolog is also essential for initiation of DNA replication as cell division occurs. Overexpression of this gene product may be associated with neoplastic transformation for some tumors. Multiple alternatively spliced transcript variants that encode the same protein have been detected. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E3.5-E6.5. In conjunction with a Trp53-null allele, double homozygous mutant embryos survive up to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,528,275 T869A probably benign Het
Aqr T A 2: 114,149,016 I313F probably damaging Het
Arid1b C A 17: 5,097,668 P615Q probably damaging Het
Asb16 C A 11: 102,277,927 Q410K probably benign Het
Ash2l T C 8: 25,823,186 E335G possibly damaging Het
AU041133 C T 10: 82,151,220 H236Y probably damaging Het
Bhmt T A 13: 93,617,648 Y351F possibly damaging Het
Birc6 T C 17: 74,579,506 S610P probably damaging Het
Cab39l T C 14: 59,499,710 probably null Het
Cdk18 T C 1: 132,116,904 H328R possibly damaging Het
Cdsn T C 17: 35,554,981 S136P unknown Het
Ces3b T A 8: 105,086,596 L203Q probably damaging Het
Cgn A G 3: 94,769,179 V840A probably damaging Het
Ctse T C 1: 131,662,753 L71P probably damaging Het
Ears2 G T 7: 122,048,340 S240R probably benign Het
Edem3 A G 1: 151,811,635 I756V possibly damaging Het
Epas1 T C 17: 86,827,699 Y587H probably benign Het
Fcamr G T 1: 130,811,706 A248S probably damaging Het
Gm14496 G A 2: 181,991,378 W51* probably null Het
Hfm1 A T 5: 106,881,791 probably null Het
Hhip T C 8: 79,998,208 I312V probably benign Het
Hmcn2 C A 2: 31,405,875 N2658K possibly damaging Het
Iars T A 13: 49,725,272 M948K probably benign Het
Il27ra A G 8: 84,031,558 L521S probably damaging Het
Itpr1 A G 6: 108,482,931 D2062G probably damaging Het
Jag2 G T 12: 112,913,180 R784S probably benign Het
Maea T A 5: 33,360,378 D87E probably benign Het
Man2a2 A G 7: 80,366,926 I380T probably damaging Het
Mprip G T 11: 59,737,089 G253W probably damaging Het
Naglu G A 11: 101,076,610 R462H probably damaging Het
Nrxn1 T A 17: 90,059,551 I342F probably damaging Het
Olfr1419 A T 19: 11,870,805 M137K probably damaging Het
Olfr1467 G A 19: 13,365,146 V173I probably benign Het
Olfr821 A G 10: 130,033,887 D87G probably damaging Het
Olfr834 T C 9: 18,988,920 S311P probably benign Het
Oosp1 C A 19: 11,691,005 V5L probably benign Het
Pbrm1 T C 14: 31,030,891 M95T probably damaging Het
Pcdh17 C G 14: 84,532,985 R968G probably damaging Het
Pcdhb7 T G 18: 37,343,862 S684A probably damaging Het
Polr1b T G 2: 129,105,280 I175R probably damaging Het
Ppp3ca A G 3: 136,797,774 D36G probably damaging Het
Prr14l G A 5: 32,844,391 probably benign Het
Rcn2 A T 9: 56,052,982 I178F probably benign Het
Sbspon T G 1: 15,860,319 K148Q probably damaging Het
Scn3a A T 2: 65,508,574 V587E probably damaging Het
Setd7 T A 3: 51,536,657 probably null Het
Sh2d5 C A 4: 138,256,797 P85T probably benign Het
Slc12a1 T A 2: 125,166,682 V204D possibly damaging Het
Slc2a8 G A 2: 32,980,068 R154* probably null Het
Slc36a3 C T 11: 55,151,198 G42S probably benign Het
Spink5 A G 18: 44,010,229 K751R probably benign Het
Sult2a5 T A 7: 13,628,843 probably null Het
Thoc5 T C 11: 4,902,306 probably benign Het
Ttn A G 2: 76,975,037 S153P probably damaging Het
Ubap2 A T 4: 41,221,615 L228Q probably benign Het
Upk3b G A 5: 136,040,139 G121S possibly damaging Het
Usp1 T A 4: 98,932,307 S456R probably damaging Het
Usp28 A T 9: 49,003,902 N126Y possibly damaging Het
Wdfy4 C T 14: 32,988,921 V2411M possibly damaging Het
Zfp595 C T 13: 67,317,705 E165K probably damaging Het
Other mutations in Cdc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Cdc7 APN 5 106968860 missense probably benign
IGL01671:Cdc7 APN 5 106983245 missense probably damaging 1.00
IGL03373:Cdc7 APN 5 106972919 splice site probably benign
R0179:Cdc7 UTSW 5 106965039 missense probably benign 0.02
R0563:Cdc7 UTSW 5 106972910 splice site probably benign
R1621:Cdc7 UTSW 5 106965054 missense probably benign
R1970:Cdc7 UTSW 5 106973074 splice site probably benign
R2044:Cdc7 UTSW 5 106983132 missense probably benign
R2993:Cdc7 UTSW 5 106973898 missense probably benign
R3110:Cdc7 UTSW 5 106974698 critical splice donor site probably null
R3112:Cdc7 UTSW 5 106974698 critical splice donor site probably null
R4700:Cdc7 UTSW 5 106973841 missense probably benign 0.00
R5396:Cdc7 UTSW 5 106969297 splice site probably null
R6217:Cdc7 UTSW 5 106972794 missense probably damaging 1.00
R6258:Cdc7 UTSW 5 106969227 missense probably damaging 1.00
R6285:Cdc7 UTSW 5 106983059 missense probably benign 0.00
R6609:Cdc7 UTSW 5 106973058 missense probably benign 0.04
R8518:Cdc7 UTSW 5 106972998 missense probably damaging 1.00
V8831:Cdc7 UTSW 5 106968910 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGTGTACAACCTTCCCTCTAAAATTC -3'
(R):5'- ACAGCGTGCATTCAACTGC -3'

Sequencing Primer
(F):5'- CATGGGACTTAAGTACTGCTTCAG -3'
(R):5'- CAGCGTGCATTCAACTGCTAATG -3'
Posted On 2019-12-03