Incidental Mutation 'R7828:Spink5'
ID602470
Institutional Source Beutler Lab
Gene Symbol Spink5
Ensembl Gene ENSMUSG00000055561
Gene Nameserine peptidase inhibitor, Kazal type 5
Synonyms2310065D10Rik, LEKT1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7828 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location43963235-44022501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44010229 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 751 (K751R)
Ref Sequence ENSEMBL: ENSMUSP00000066214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069245]
Predicted Effect probably benign
Transcript: ENSMUST00000069245
AA Change: K751R

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: K751R

DomainStartEndE-ValueType
PDB:1UUC|A 26 77 3e-6 PDB
KAZAL 97 152 1.67e-15 SMART
KAZAL 161 216 2.07e-3 SMART
KAZAL 226 281 3.37e-11 SMART
KAZAL 298 353 2.92e-6 SMART
KAZAL 367 424 6.73e-3 SMART
KAZAL 426 480 6.07e-4 SMART
KAZAL 496 558 2.43e-1 SMART
KAZAL 559 614 2.72e-15 SMART
KAZAL 633 687 1.95e-7 SMART
KAZAL 700 755 1.01e-9 SMART
KAZAL 769 824 7.29e-7 SMART
KAZAL 865 931 1.32e-4 SMART
KAZAL 942 996 2.74e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,528,275 T869A probably benign Het
Aqr T A 2: 114,149,016 I313F probably damaging Het
Arid1b C A 17: 5,097,668 P615Q probably damaging Het
Asb16 C A 11: 102,277,927 Q410K probably benign Het
Ash2l T C 8: 25,823,186 E335G possibly damaging Het
AU041133 C T 10: 82,151,220 H236Y probably damaging Het
Bhmt T A 13: 93,617,648 Y351F possibly damaging Het
Birc6 T C 17: 74,579,506 S610P probably damaging Het
Cab39l T C 14: 59,499,710 probably null Het
Cdc7 A T 5: 106,972,950 Q146L possibly damaging Het
Cdk18 T C 1: 132,116,904 H328R possibly damaging Het
Cdsn T C 17: 35,554,981 S136P unknown Het
Ces3b T A 8: 105,086,596 L203Q probably damaging Het
Cgn A G 3: 94,769,179 V840A probably damaging Het
Ctse T C 1: 131,662,753 L71P probably damaging Het
Ears2 G T 7: 122,048,340 S240R probably benign Het
Edem3 A G 1: 151,811,635 I756V possibly damaging Het
Epas1 T C 17: 86,827,699 Y587H probably benign Het
Fcamr G T 1: 130,811,706 A248S probably damaging Het
Gm14496 G A 2: 181,991,378 W51* probably null Het
Hfm1 A T 5: 106,881,791 probably null Het
Hhip T C 8: 79,998,208 I312V probably benign Het
Hmcn2 C A 2: 31,405,875 N2658K possibly damaging Het
Iars T A 13: 49,725,272 M948K probably benign Het
Il27ra A G 8: 84,031,558 L521S probably damaging Het
Itpr1 A G 6: 108,482,931 D2062G probably damaging Het
Jag2 G T 12: 112,913,180 R784S probably benign Het
Maea T A 5: 33,360,378 D87E probably benign Het
Man2a2 A G 7: 80,366,926 I380T probably damaging Het
Mprip G T 11: 59,737,089 G253W probably damaging Het
Naglu G A 11: 101,076,610 R462H probably damaging Het
Nrxn1 T A 17: 90,059,551 I342F probably damaging Het
Olfr1419 A T 19: 11,870,805 M137K probably damaging Het
Olfr1467 G A 19: 13,365,146 V173I probably benign Het
Olfr821 A G 10: 130,033,887 D87G probably damaging Het
Olfr834 T C 9: 18,988,920 S311P probably benign Het
Oosp1 C A 19: 11,691,005 V5L probably benign Het
Pbrm1 T C 14: 31,030,891 M95T probably damaging Het
Pcdh17 C G 14: 84,532,985 R968G probably damaging Het
Pcdhb7 T G 18: 37,343,862 S684A probably damaging Het
Polr1b T G 2: 129,105,280 I175R probably damaging Het
Ppp3ca A G 3: 136,797,774 D36G probably damaging Het
Prr14l G A 5: 32,844,391 probably benign Het
Rcn2 A T 9: 56,052,982 I178F probably benign Het
Sbspon T G 1: 15,860,319 K148Q probably damaging Het
Scn3a A T 2: 65,508,574 V587E probably damaging Het
Setd7 T A 3: 51,536,657 probably null Het
Sh2d5 C A 4: 138,256,797 P85T probably benign Het
Slc12a1 T A 2: 125,166,682 V204D possibly damaging Het
Slc2a8 G A 2: 32,980,068 R154* probably null Het
Slc36a3 C T 11: 55,151,198 G42S probably benign Het
Sult2a5 T A 7: 13,628,843 probably null Het
Thoc5 T C 11: 4,902,306 probably benign Het
Ttn A G 2: 76,975,037 S153P probably damaging Het
Ubap2 A T 4: 41,221,615 L228Q probably benign Het
Upk3b G A 5: 136,040,139 G121S possibly damaging Het
Usp1 T A 4: 98,932,307 S456R probably damaging Het
Usp28 A T 9: 49,003,902 N126Y possibly damaging Het
Wdfy4 C T 14: 32,988,921 V2411M possibly damaging Het
Zfp595 C T 13: 67,317,705 E165K probably damaging Het
Other mutations in Spink5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Spink5 APN 18 43987871 splice site probably benign
IGL00332:Spink5 APN 18 43967044 missense probably benign 0.00
IGL00501:Spink5 APN 18 43977739 missense probably damaging 0.98
IGL00772:Spink5 APN 18 44006420 missense probably benign 0.02
IGL00920:Spink5 APN 18 44003209 missense probably damaging 1.00
IGL00980:Spink5 APN 18 44007710 missense probably damaging 1.00
IGL01016:Spink5 APN 18 44007644 missense probably damaging 1.00
IGL01155:Spink5 APN 18 43981147 missense probably benign 0.01
IGL01374:Spink5 APN 18 43989404 missense possibly damaging 0.74
IGL01629:Spink5 APN 18 43996610 splice site probably benign
IGL01907:Spink5 APN 18 43996676 missense probably damaging 1.00
IGL01931:Spink5 APN 18 44015638 missense probably benign 0.02
IGL02237:Spink5 APN 18 44012867 missense probably benign 0.03
IGL02306:Spink5 APN 18 43964444 missense probably damaging 0.98
IGL02402:Spink5 APN 18 43967104 missense probably damaging 1.00
IGL02425:Spink5 APN 18 43990744 critical splice donor site probably null
IGL02552:Spink5 APN 18 43992168 missense possibly damaging 0.80
IGL02554:Spink5 APN 18 44015594 missense probably benign 0.01
IGL03066:Spink5 APN 18 44016390 missense probably damaging 1.00
IGL03288:Spink5 APN 18 44014760 missense possibly damaging 0.59
crusty2 UTSW 18 43999935 splice site probably benign
R0079:Spink5 UTSW 18 43977764 missense probably damaging 1.00
R0184:Spink5 UTSW 18 44003198 missense probably benign 0.00
R0452:Spink5 UTSW 18 43963318 missense possibly damaging 0.74
R0569:Spink5 UTSW 18 43989419 missense probably damaging 1.00
R0639:Spink5 UTSW 18 44012975 splice site probably null
R0648:Spink5 UTSW 18 43999797 splice site probably benign
R0705:Spink5 UTSW 18 43992274 missense probably benign 0.01
R1170:Spink5 UTSW 18 43983563 missense probably benign 0.07
R1290:Spink5 UTSW 18 44007711 missense probably damaging 0.99
R1345:Spink5 UTSW 18 43990682 missense possibly damaging 0.88
R1458:Spink5 UTSW 18 44007719 missense probably benign 0.01
R1530:Spink5 UTSW 18 44015671 missense probably damaging 0.96
R1570:Spink5 UTSW 18 43967107 missense probably benign 0.00
R1820:Spink5 UTSW 18 43989419 missense possibly damaging 0.94
R1843:Spink5 UTSW 18 43999891 missense probably benign 0.03
R1968:Spink5 UTSW 18 43990708 missense probably benign 0.06
R2050:Spink5 UTSW 18 44007758 critical splice donor site probably null
R2252:Spink5 UTSW 18 44020824 nonsense probably null
R2278:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2279:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2696:Spink5 UTSW 18 43982292 missense probably damaging 1.00
R2992:Spink5 UTSW 18 43996629 missense probably damaging 1.00
R3422:Spink5 UTSW 18 44010244 missense probably benign 0.01
R3934:Spink5 UTSW 18 44016427 missense probably damaging 1.00
R4179:Spink5 UTSW 18 43987867 missense probably benign
R4854:Spink5 UTSW 18 44020841 makesense probably null
R5011:Spink5 UTSW 18 44006412 missense probably damaging 0.97
R5133:Spink5 UTSW 18 43986423 missense probably damaging 1.00
R5163:Spink5 UTSW 18 43999857 missense possibly damaging 0.95
R5185:Spink5 UTSW 18 44015644 missense probably damaging 0.97
R5187:Spink5 UTSW 18 43989451 missense probably damaging 1.00
R5292:Spink5 UTSW 18 44006454 missense probably benign
R5332:Spink5 UTSW 18 43992917 missense possibly damaging 0.89
R5600:Spink5 UTSW 18 44018711 missense probably damaging 0.96
R6267:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6296:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6373:Spink5 UTSW 18 43990672 missense probably damaging 1.00
R6982:Spink5 UTSW 18 43977725 missense probably damaging 1.00
R6982:Spink5 UTSW 18 44010042 splice site probably null
R7332:Spink5 UTSW 18 43982250 missense probably damaging 0.96
R7396:Spink5 UTSW 18 43977655 missense possibly damaging 0.95
R7643:Spink5 UTSW 18 44010252 missense probably benign 0.37
R7726:Spink5 UTSW 18 43963352 missense probably damaging 1.00
R7836:Spink5 UTSW 18 43999821 missense probably benign 0.00
R7880:Spink5 UTSW 18 43986326 missense probably benign 0.40
R7919:Spink5 UTSW 18 43999821 missense probably benign 0.00
R7963:Spink5 UTSW 18 43986326 missense probably benign 0.40
R8031:Spink5 UTSW 18 44010236 missense probably benign 0.07
Z1177:Spink5 UTSW 18 43996635 missense probably damaging 0.97
Z1177:Spink5 UTSW 18 43996697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTTCCAAAACAGAGGTTGGG -3'
(R):5'- GAACCACCTCGTTCACTGTG -3'

Sequencing Primer
(F):5'- ACAGAGGTTGGGCTGGG -3'
(R):5'- ATGACTCCCATGGATGCATC -3'
Posted On2019-12-03