Incidental Mutation 'R7828:Olfr1419'
ID602472
Institutional Source Beutler Lab
Gene Symbol Olfr1419
Ensembl Gene ENSMUSG00000067545
Gene Nameolfactory receptor 1419
SynonymsMOR266-10, GA_x6K02T2RE5P-2222521-2221490
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R7828 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location11868613-11875106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11870805 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 137 (M137K)
Ref Sequence ENSEMBL: ENSMUSP00000148848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087857] [ENSMUST00000213954] [ENSMUST00000217617]
Predicted Effect probably damaging
Transcript: ENSMUST00000087857
AA Change: M137K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085163
Gene: ENSMUSG00000067545
AA Change: M137K

DomainStartEndE-ValueType
Pfam:7tm_4 31 309 3.8e-55 PFAM
Pfam:7tm_1 41 291 2.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213954
AA Change: M137K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217617
AA Change: M137K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,528,275 T869A probably benign Het
Aqr T A 2: 114,149,016 I313F probably damaging Het
Arid1b C A 17: 5,097,668 P615Q probably damaging Het
Asb16 C A 11: 102,277,927 Q410K probably benign Het
Ash2l T C 8: 25,823,186 E335G possibly damaging Het
AU041133 C T 10: 82,151,220 H236Y probably damaging Het
Bhmt T A 13: 93,617,648 Y351F possibly damaging Het
Birc6 T C 17: 74,579,506 S610P probably damaging Het
Cab39l T C 14: 59,499,710 probably null Het
Cdc7 A T 5: 106,972,950 Q146L possibly damaging Het
Cdk18 T C 1: 132,116,904 H328R possibly damaging Het
Cdsn T C 17: 35,554,981 S136P unknown Het
Ces3b T A 8: 105,086,596 L203Q probably damaging Het
Cgn A G 3: 94,769,179 V840A probably damaging Het
Ctse T C 1: 131,662,753 L71P probably damaging Het
Ears2 G T 7: 122,048,340 S240R probably benign Het
Edem3 A G 1: 151,811,635 I756V possibly damaging Het
Epas1 T C 17: 86,827,699 Y587H probably benign Het
Fcamr G T 1: 130,811,706 A248S probably damaging Het
Gm14496 G A 2: 181,991,378 W51* probably null Het
Hfm1 A T 5: 106,881,791 probably null Het
Hhip T C 8: 79,998,208 I312V probably benign Het
Hmcn2 C A 2: 31,405,875 N2658K possibly damaging Het
Iars T A 13: 49,725,272 M948K probably benign Het
Il27ra A G 8: 84,031,558 L521S probably damaging Het
Itpr1 A G 6: 108,482,931 D2062G probably damaging Het
Jag2 G T 12: 112,913,180 R784S probably benign Het
Maea T A 5: 33,360,378 D87E probably benign Het
Man2a2 A G 7: 80,366,926 I380T probably damaging Het
Mprip G T 11: 59,737,089 G253W probably damaging Het
Naglu G A 11: 101,076,610 R462H probably damaging Het
Nrxn1 T A 17: 90,059,551 I342F probably damaging Het
Olfr1467 G A 19: 13,365,146 V173I probably benign Het
Olfr821 A G 10: 130,033,887 D87G probably damaging Het
Olfr834 T C 9: 18,988,920 S311P probably benign Het
Oosp1 C A 19: 11,691,005 V5L probably benign Het
Pbrm1 T C 14: 31,030,891 M95T probably damaging Het
Pcdh17 C G 14: 84,532,985 R968G probably damaging Het
Pcdhb7 T G 18: 37,343,862 S684A probably damaging Het
Polr1b T G 2: 129,105,280 I175R probably damaging Het
Ppp3ca A G 3: 136,797,774 D36G probably damaging Het
Prr14l G A 5: 32,844,391 probably benign Het
Rcn2 A T 9: 56,052,982 I178F probably benign Het
Sbspon T G 1: 15,860,319 K148Q probably damaging Het
Scn3a A T 2: 65,508,574 V587E probably damaging Het
Setd7 T A 3: 51,536,657 probably null Het
Sh2d5 C A 4: 138,256,797 P85T probably benign Het
Slc12a1 T A 2: 125,166,682 V204D possibly damaging Het
Slc2a8 G A 2: 32,980,068 R154* probably null Het
Slc36a3 C T 11: 55,151,198 G42S probably benign Het
Spink5 A G 18: 44,010,229 K751R probably benign Het
Sult2a5 T A 7: 13,628,843 probably null Het
Thoc5 T C 11: 4,902,306 probably benign Het
Ttn A G 2: 76,975,037 S153P probably damaging Het
Ubap2 A T 4: 41,221,615 L228Q probably benign Het
Upk3b G A 5: 136,040,139 G121S possibly damaging Het
Usp1 T A 4: 98,932,307 S456R probably damaging Het
Usp28 A T 9: 49,003,902 N126Y possibly damaging Het
Wdfy4 C T 14: 32,988,921 V2411M possibly damaging Het
Zfp595 C T 13: 67,317,705 E165K probably damaging Het
Other mutations in Olfr1419
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Olfr1419 APN 19 11870524 missense probably benign 0.05
IGL01979:Olfr1419 APN 19 11871223 splice site probably benign
IGL02961:Olfr1419 APN 19 11870331 missense probably damaging 1.00
R0285:Olfr1419 UTSW 19 11871138 missense probably damaging 0.97
R0347:Olfr1419 UTSW 19 11870433 missense probably damaging 1.00
R1577:Olfr1419 UTSW 19 11870377 missense probably damaging 1.00
R2391:Olfr1419 UTSW 19 11870816 nonsense probably null
R3977:Olfr1419 UTSW 19 11870505 missense possibly damaging 0.82
R4660:Olfr1419 UTSW 19 11871048 missense possibly damaging 0.64
R5201:Olfr1419 UTSW 19 11870631 missense probably benign 0.21
R5995:Olfr1419 UTSW 19 11870862 missense possibly damaging 0.89
R6393:Olfr1419 UTSW 19 11870727 missense probably damaging 1.00
R7466:Olfr1419 UTSW 19 11870316 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGAGAGCTGCCTGGTGTATATG -3'
(R):5'- TGGCCACATTAGAGCTTGGC -3'

Sequencing Primer
(F):5'- ATATGGGTATCTGTACAGGCCAG -3'
(R):5'- GGCCACATTAGAGCTTGGCTATTC -3'
Posted On2019-12-03