Incidental Mutation 'RF001:Gm14412'
ID 602485
Institutional Source Beutler Lab
Gene Symbol Gm14412
Ensembl Gene ENSMUSG00000078868
Gene Name predicted gene 14412
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.661) question?
Stock # RF001 (G1)
Quality Score 95.0077
Status Not validated
Chromosome 2
Chromosomal Location 177314520-177324307 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 177317101 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 52 (I52V)
Ref Sequence ENSEMBL: ENSMUSP00000104587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108959]
AlphaFold A2ARR7
Predicted Effect probably benign
Transcript: ENSMUST00000108959
AA Change: I52V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104587
Gene: ENSMUSG00000078868
AA Change: I52V

DomainStartEndE-ValueType
KRAB 4 66 1.54e-15 SMART
ZnF_C2H2 103 125 1.12e-3 SMART
ZnF_C2H2 131 153 2.15e-5 SMART
ZnF_C2H2 159 181 5.59e-4 SMART
ZnF_C2H2 187 209 1.98e-4 SMART
ZnF_C2H2 215 237 1.12e-3 SMART
ZnF_C2H2 243 265 6.52e-5 SMART
ZnF_C2H2 271 293 1.12e-3 SMART
ZnF_C2H2 299 321 5.59e-4 SMART
ZnF_C2H2 327 349 4.87e-4 SMART
ZnF_C2H2 355 377 2.61e-4 SMART
ZnF_C2H2 383 405 9.08e-4 SMART
ZnF_C2H2 411 433 4.87e-4 SMART
ZnF_C2H2 439 461 6.88e-4 SMART
ZnF_C2H2 467 489 4.61e-5 SMART
ZnF_C2H2 495 517 8.02e-5 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik G GTGGCTGCTA 1: 82,913,590 probably benign Het
Acer1 A G 17: 56,958,909 V122A probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,921 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Atp13a1 C A 8: 69,800,070 A680D probably damaging Het
Blm CGCCTCCTCCTC CGCCTCCTCCTCAGCCTCCTCCTC 7: 80,512,903 probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTCCTCCTCCTCCTC 7: 80,512,906 probably benign Het
Blm CTCCTCC CTCCTCCTCCTCGTCCTCC 7: 80,512,927 probably benign Het
Cad GT G 5: 31,060,212 probably benign Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,141,276 probably benign Het
Casz1 CACA C 4: 148,952,304 probably benign Het
Cherp GACCTGGA G 8: 72,462,049 probably null Het
Chga AGC AGCTGC 12: 102,561,423 probably benign Het
Coq7 A G 7: 118,533,182 S24P probably benign Het
Cul1 T C 6: 47,524,581 V734A possibly damaging Het
Cyb5r4 GCCCAGGGATGTGACAGACACACT GCCCAGGGATGTGACAGACACACTCCCCAGGGATGTGACAGACACACT 9: 87,040,416 probably benign Het
Dgkz A T 2: 91,939,941 F521I possibly damaging Het
Fam171b GCAGCA GCAGCATCAGCA 2: 83,812,886 probably benign Het
Fat1 T G 8: 44,988,966 S1102A probably benign Het
Gab3 CTT CTTTTT X: 75,000,018 probably benign Het
Gm5346 T G 8: 43,626,905 D94A possibly damaging Het
Gm5414 T C 15: 101,627,953 E79G probably benign Het
Gpc5 G A 14: 115,417,178 S470N probably benign Het
Grin2b A G 6: 136,044,240 V21A probably benign Het
Hecw1 C A 13: 14,297,424 C553F probably damaging Het
Hsd3b6 T A 3: 98,806,440 H181L probably benign Het
Il2 CCAGGTGCTGCTGC CC 3: 37,125,762 probably benign Het
Inpp5f G A 7: 128,695,083 G1053R probably damaging Het
Kcnma1 T G 14: 23,311,697 Y1142S probably damaging Het
Kctd8 T C 5: 69,110,432 K445R possibly damaging Het
Kmt2b CC CCTCCTTC 7: 30,586,382 probably benign Het
Kmt2c TG TGTTGCGG 5: 25,315,775 probably benign Het
Krtap28-10 CACAGCCACAGCCACCACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCACCACAGCCACAGCCAC 1: 83,042,255 probably benign Het
Krtap28-10 GCCACCACAGC GCCACCACAGCCACATCCACCACAGC 1: 83,042,280 probably benign Het
Krtap28-10 CACCAC CACCACCGCCACCGCAACCAC 1: 83,042,282 probably benign Het
Lama1 A G 17: 67,752,902 D662G Het
Lce1m AC ACTGCTGCTGCCCC 3: 93,018,152 probably benign Het
Lce1m GCTGCCACC GCTGCCACCACTCCTGCCACC 3: 93,018,269 probably benign Het
Lmo4 A C 3: 144,201,862 S63A possibly damaging Het
Lrrk2 T C 15: 91,736,633 I952T probably benign Het
Lyst T C 13: 13,635,841 F699L probably benign Het
Matn3 T A 12: 8,958,797 D303E probably benign Het
Me1 A G 9: 86,582,823 Y545H probably damaging Het
Mettl3 A T 14: 52,300,299 V68E probably benign Het
Mptx2 T C 1: 173,274,969 N51S probably benign Het
Mylk A G 16: 34,879,371 D368G probably benign Het
Myom2 T C 8: 15,081,418 V372A possibly damaging Het
Neb T C 2: 52,195,421 D5569G probably damaging Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGCGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,030 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Rbm12 CC CCGGGTATTGTGGGACCAGTTATTGCGGGAGC 2: 156,096,075 probably benign Het
Sertad4 T C 1: 192,847,178 Y110C probably damaging Het
Setd1a GGTAGTGGT GGTAGTGGTAGTAGTGGT 7: 127,785,314 probably benign Het
Smarca2 ACA ACAACAGCA 19: 26,630,986 probably benign Het
Smarca2 AGC AGCCCCGGC 19: 26,631,021 probably benign Het
Supt20 AGCA AGCACCCGCA 3: 54,727,662 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tecpr1 A G 5: 144,217,386 F83S probably damaging Het
Triobp GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA 15: 78,967,027 probably benign Het
Vmn1r48 A T 6: 90,036,204 M213K probably benign Het
Zc3h4 CCC CCCTGACATGCATCC 7: 16,429,687 probably benign Het
Zscan29 T C 2: 121,163,996 N503D possibly damaging Het
Other mutations in Gm14412
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gm14412 APN 2 177315686 missense probably benign
R0124:Gm14412 UTSW 2 177315912 splice site probably benign
R0507:Gm14412 UTSW 2 177314532 missense possibly damaging 0.46
R1833:Gm14412 UTSW 2 177315790 missense probably benign 0.00
R1908:Gm14412 UTSW 2 177315476 missense probably damaging 1.00
R1908:Gm14412 UTSW 2 177315837 missense probably benign 0.03
R2026:Gm14412 UTSW 2 177317105 missense possibly damaging 0.92
R2209:Gm14412 UTSW 2 177317436 missense probably damaging 1.00
R2656:Gm14412 UTSW 2 177315200 missense unknown
R3946:Gm14412 UTSW 2 177314685 nonsense probably null
R4430:Gm14412 UTSW 2 177315832 missense probably benign 0.09
R4537:Gm14412 UTSW 2 177314559 missense probably benign 0.06
R4595:Gm14412 UTSW 2 177315212 missense unknown
R4928:Gm14412 UTSW 2 177314580 missense probably benign 0.01
R5100:Gm14412 UTSW 2 177315115 missense probably damaging 0.99
R5434:Gm14412 UTSW 2 177314612 missense probably damaging 1.00
R5668:Gm14412 UTSW 2 177315609 nonsense probably null
R6173:Gm14412 UTSW 2 177314537 missense probably damaging 1.00
R6558:Gm14412 UTSW 2 177314554 missense probably damaging 0.99
R6784:Gm14412 UTSW 2 177317340 missense probably benign 0.10
R7094:Gm14412 UTSW 2 177317345 missense probably damaging 1.00
R7182:Gm14412 UTSW 2 177315615 missense probably benign 0.44
R7254:Gm14412 UTSW 2 177317396 missense probably damaging 0.97
R7793:Gm14412 UTSW 2 177315867 missense possibly damaging 0.78
R7799:Gm14412 UTSW 2 177315797 missense probably benign 0.01
R8238:Gm14412 UTSW 2 177315318 missense unknown
R9098:Gm14412 UTSW 2 177314563 missense probably damaging 1.00
R9304:Gm14412 UTSW 2 177315754 missense probably benign
RF007:Gm14412 UTSW 2 177315701 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CACACTTGTACAGCATAGCTCT -3'
(R):5'- TCCTTCTCAGAAGAGTCTCTACAAAG -3'

Sequencing Primer
(F):5'- CACTTGTACAGCATAGCTCTACTAGG -3'
(R):5'- GAGTCTCTACAAAGATGTGATGC -3'
Posted On 2019-12-04