Incidental Mutation 'RF001:Tecpr1'
ID602496
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Nametectonin beta-propeller repeat containing 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location144194442-144223615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144217386 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 83 (F83S)
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085701]
Predicted Effect probably damaging
Transcript: ENSMUST00000085701
AA Change: F83S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: F83S

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik G GTGGCTGCTA 1: 82,913,590 probably benign Het
Acer1 A G 17: 56,958,909 V122A probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,921 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Atp13a1 C A 8: 69,800,070 A680D probably damaging Het
Blm CGCCTCCTCCTC CGCCTCCTCCTCAGCCTCCTCCTC 7: 80,512,903 probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTCCTCCTCCTCCTC 7: 80,512,906 probably benign Het
Blm CTCCTCC CTCCTCCTCCTCGTCCTCC 7: 80,512,927 probably benign Het
Cad GT G 5: 31,060,212 probably benign Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,141,276 probably benign Het
Casz1 CACA C 4: 148,952,304 probably benign Het
Cherp GACCTGGA G 8: 72,462,049 probably null Het
Chga AGC AGCTGC 12: 102,561,423 probably benign Het
Coq7 A G 7: 118,533,182 S24P probably benign Het
Cul1 T C 6: 47,524,581 V734A possibly damaging Het
Cyb5r4 GCCCAGGGATGTGACAGACACACT GCCCAGGGATGTGACAGACACACTCCCCAGGGATGTGACAGACACACT 9: 87,040,416 probably benign Het
Dgkz A T 2: 91,939,941 F521I possibly damaging Het
Fam171b GCAGCA GCAGCATCAGCA 2: 83,812,886 probably benign Het
Fat1 T G 8: 44,988,966 S1102A probably benign Het
Gab3 CTT CTTTTT X: 75,000,018 probably benign Het
Gm14412 T C 2: 177,317,101 I52V probably benign Het
Gm5346 T G 8: 43,626,905 D94A possibly damaging Het
Gm5414 T C 15: 101,627,953 E79G probably benign Het
Gpc5 G A 14: 115,417,178 S470N probably benign Het
Grin2b A G 6: 136,044,240 V21A probably benign Het
Hecw1 C A 13: 14,297,424 C553F probably damaging Het
Hsd3b6 T A 3: 98,806,440 H181L probably benign Het
Il2 CCAGGTGCTGCTGC CC 3: 37,125,762 probably benign Het
Inpp5f G A 7: 128,695,083 G1053R probably damaging Het
Kcnma1 T G 14: 23,311,697 Y1142S probably damaging Het
Kctd8 T C 5: 69,110,432 K445R possibly damaging Het
Kmt2b CC CCTCCTTC 7: 30,586,382 probably benign Het
Kmt2c TG TGTTGCGG 5: 25,315,775 probably benign Het
Krtap28-10 CACAGCCACAGCCACCACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCACCACAGCCACAGCCAC 1: 83,042,255 probably benign Het
Krtap28-10 GCCACCACAGC GCCACCACAGCCACATCCACCACAGC 1: 83,042,280 probably benign Het
Krtap28-10 CACCAC CACCACCGCCACCGCAACCAC 1: 83,042,282 probably benign Het
Lama1 A G 17: 67,752,902 D662G Het
Lce1m AC ACTGCTGCTGCCCC 3: 93,018,152 probably benign Het
Lce1m GCTGCCACC GCTGCCACCACTCCTGCCACC 3: 93,018,269 probably benign Het
Lmo4 A C 3: 144,201,862 S63A possibly damaging Het
Lrrk2 T C 15: 91,736,633 I952T probably benign Het
Lyst T C 13: 13,635,841 F699L probably benign Het
Matn3 T A 12: 8,958,797 D303E probably benign Het
Me1 A G 9: 86,582,823 Y545H probably damaging Het
Mettl3 A T 14: 52,300,299 V68E probably benign Het
Mptx2 T C 1: 173,274,969 N51S probably benign Het
Mylk A G 16: 34,879,371 D368G probably benign Het
Myom2 T C 8: 15,081,418 V372A possibly damaging Het
Neb T C 2: 52,195,421 D5569G probably damaging Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGCGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,030 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Rbm12 CC CCGGGTATTGTGGGACCAGTTATTGCGGGAGC 2: 156,096,075 probably benign Het
Sertad4 T C 1: 192,847,178 Y110C probably damaging Het
Setd1a GGTAGTGGT GGTAGTGGTAGTAGTGGT 7: 127,785,314 probably benign Het
Smarca2 ACA ACAACAGCA 19: 26,630,986 probably benign Het
Smarca2 AGC AGCCCCGGC 19: 26,631,021 probably benign Het
Supt20 AGCA AGCACCCGCA 3: 54,727,662 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Triobp GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA 15: 78,967,027 probably benign Het
Vmn1r48 A T 6: 90,036,204 M213K probably benign Het
Zc3h4 CCC CCCTGACATGCATCC 7: 16,429,687 probably benign Het
Zscan29 T C 2: 121,163,996 N503D possibly damaging Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144208593 critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144211540 missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144216919 missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144197988 splice site probably benign
IGL02244:Tecpr1 APN 5 144210003 missense probably benign
IGL02247:Tecpr1 APN 5 144206554 missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144203487 missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144206546 missense probably benign 0.28
larghissimo UTSW 5 144217257 missense probably damaging 1.00
PIT4531001:Tecpr1 UTSW 5 144214067 missense probably damaging 0.96
R0121:Tecpr1 UTSW 5 144210199 missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144197899 missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144218517 missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144207476 missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144195941 missense probably benign
R0504:Tecpr1 UTSW 5 144214081 missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144206274 missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144217401 missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144212590 missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144211499 missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144214053 splice site probably null
R0835:Tecpr1 UTSW 5 144212592 missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144216929 missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144206539 missense possibly damaging 0.77
R1597:Tecpr1 UTSW 5 144214310 missense probably benign 0.00
R1663:Tecpr1 UTSW 5 144197944 missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144208608 missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144206529 missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144204697 missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2133:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144196417 missense probably damaging 1.00
R2172:Tecpr1 UTSW 5 144211456 missense probably benign 0.10
R2290:Tecpr1 UTSW 5 144214063 missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144209979 missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144206259 missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144212590 missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144207437 missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144214117 missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144204658 missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144217257 missense probably damaging 1.00
R5043:Tecpr1 UTSW 5 144197854 splice site probably null
R5459:Tecpr1 UTSW 5 144207416 missense probably damaging 1.00
R5579:Tecpr1 UTSW 5 144214344 missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144218633 nonsense probably null
R5679:Tecpr1 UTSW 5 144207423 missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144206546 missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144211421 missense probably benign 0.02
R6022:Tecpr1 UTSW 5 144199191 missense possibly damaging 0.95
R6114:Tecpr1 UTSW 5 144204640 missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144198576 missense probably damaging 0.97
R6372:Tecpr1 UTSW 5 144216958 missense probably damaging 1.00
R6493:Tecpr1 UTSW 5 144209974 missense probably benign
R7276:Tecpr1 UTSW 5 144217020 nonsense probably null
R7314:Tecpr1 UTSW 5 144217332 missense probably damaging 1.00
R7375:Tecpr1 UTSW 5 144208599 missense possibly damaging 0.68
R7632:Tecpr1 UTSW 5 144218726 missense probably benign 0.03
R7702:Tecpr1 UTSW 5 144203418 missense probably damaging 1.00
R8135:Tecpr1 UTSW 5 144198602 missense probably damaging 0.99
R8406:Tecpr1 UTSW 5 144200840 missense probably damaging 1.00
R8844:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8856:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8857:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8866:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8926:Tecpr1 UTSW 5 144216962 missense probably damaging 1.00
Z1176:Tecpr1 UTSW 5 144218591 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGGTATTCAATCCCGGAGCAG -3'
(R):5'- ATCATCCTAGGCCCTGCATC -3'

Sequencing Primer
(F):5'- CATGGAGGGTACTGAGTTCACCTAC -3'
(R):5'- AGGCCCTGCATCCCACATTG -3'
Posted On2019-12-04