Incidental Mutation 'RF001:Cul1'
ID 602497
Institutional Source Beutler Lab
Gene Symbol Cul1
Ensembl Gene ENSMUSG00000029686
Gene Name cullin 1
Synonyms
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 47430516-47503078 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 47501515 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 734 (V734A)
Ref Sequence ENSEMBL: ENSMUSP00000031697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031697] [ENSMUST00000146200]
AlphaFold Q9WTX6
Predicted Effect possibly damaging
Transcript: ENSMUST00000031697
AA Change: V734A

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031697
Gene: ENSMUSG00000029686
AA Change: V734A

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-174 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Cullin_Nedd8 703 770 6.19e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146200
SMART Domains Protein: ENSMUSP00000122702
Gene: ENSMUSG00000029686

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-176 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations accumulate cyclin E1 and exhibit arrested development and lethality around embryonic day 6.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik G GTGGCTGCTA 1: 82,891,311 (GRCm39) probably benign Het
Acer1 A G 17: 57,265,909 (GRCm39) V122A probably benign Het
Adam34l T G 8: 44,079,942 (GRCm39) D94A possibly damaging Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,693,974 (GRCm39) probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,479,405 (GRCm39) probably benign Het
Atp13a1 C A 8: 70,252,720 (GRCm39) A680D probably damaging Het
Blm CGCCTCCTCCTC CGCCTCCTCCTCAGCCTCCTCCTC 7: 80,162,651 (GRCm39) probably benign Het
Blm CTCCTCC CTCCTCCTCCTCGTCCTCC 7: 80,162,675 (GRCm39) probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTCCTCCTCCTCCTC 7: 80,162,654 (GRCm39) probably benign Het
Cad GT G 5: 31,217,556 (GRCm39) probably benign Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,129,715 (GRCm39) probably benign Het
Casz1 CACA C 4: 149,036,761 (GRCm39) probably benign Het
Cherp GACCTGGA G 8: 73,215,893 (GRCm39) probably null Het
Chga AGC AGCTGC 12: 102,527,682 (GRCm39) probably benign Het
Coq7 A G 7: 118,132,405 (GRCm39) S24P probably benign Het
Cyb5r4 GCCCAGGGATGTGACAGACACACT GCCCAGGGATGTGACAGACACACTCCCCAGGGATGTGACAGACACACT 9: 86,922,469 (GRCm39) probably benign Het
Dgkz A T 2: 91,770,286 (GRCm39) F521I possibly damaging Het
Fam171b GCAGCA GCAGCATCAGCA 2: 83,643,230 (GRCm39) probably benign Het
Fat1 T G 8: 45,442,003 (GRCm39) S1102A probably benign Het
Gab3 CTT CTTTTT X: 74,043,624 (GRCm39) probably benign Het
Gm14412 T C 2: 177,008,894 (GRCm39) I52V probably benign Het
Gm5414 T C 15: 101,536,388 (GRCm39) E79G probably benign Het
Gpc5 G A 14: 115,654,590 (GRCm39) S470N probably benign Het
Grin2b A G 6: 136,021,238 (GRCm39) V21A probably benign Het
Hecw1 C A 13: 14,472,009 (GRCm39) C553F probably damaging Het
Hsd3b6 T A 3: 98,713,756 (GRCm39) H181L probably benign Het
Il2 CCAGGTGCTGCTGC CC 3: 37,179,911 (GRCm39) probably benign Het
Inpp5f G A 7: 128,296,807 (GRCm39) G1053R probably damaging Het
Kcnma1 T G 14: 23,361,765 (GRCm39) Y1142S probably damaging Het
Kctd8 T C 5: 69,267,775 (GRCm39) K445R possibly damaging Het
Kmt2b CC CCTCCTTC 7: 30,285,807 (GRCm39) probably benign Het
Kmt2c TG TGTTGCGG 5: 25,520,773 (GRCm39) probably benign Het
Krtap28-10 CACCAC CACCACCGCCACCGCAACCAC 1: 83,020,003 (GRCm39) probably benign Het
Krtap28-10 CACAGCCACAGCCACCACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCACCACAGCCACAGCCAC 1: 83,019,976 (GRCm39) probably benign Het
Krtap28-10 GCCACCACAGC GCCACCACAGCCACATCCACCACAGC 1: 83,020,001 (GRCm39) probably benign Het
Lama1 A G 17: 68,059,897 (GRCm39) D662G Het
Lce1m AC ACTGCTGCTGCCCC 3: 92,925,459 (GRCm39) probably benign Het
Lce1m GCTGCCACC GCTGCCACCACTCCTGCCACC 3: 92,925,576 (GRCm39) probably benign Het
Lmo4 A C 3: 143,907,623 (GRCm39) S63A possibly damaging Het
Lrrk2 T C 15: 91,620,836 (GRCm39) I952T probably benign Het
Lyst T C 13: 13,810,426 (GRCm39) F699L probably benign Het
Matn3 T A 12: 9,008,797 (GRCm39) D303E probably benign Het
Me1 A G 9: 86,464,876 (GRCm39) Y545H probably damaging Het
Mettl3 A T 14: 52,537,756 (GRCm39) V68E probably benign Het
Mptx2 T C 1: 173,102,536 (GRCm39) N51S probably benign Het
Mylk A G 16: 34,699,741 (GRCm39) D368G probably benign Het
Myom2 T C 8: 15,131,418 (GRCm39) V372A possibly damaging Het
Neb T C 2: 52,085,433 (GRCm39) D5569G probably damaging Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGCGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,030 (GRCm39) probably benign Het
P4ha2 CCAGGTG C 11: 54,001,061 (GRCm39) probably benign Het
Pop1 G A 15: 34,502,583 (GRCm39) G90D probably damaging Het
Rbm12 CC CCGGGTATTGTGGGACCAGTTATTGCGGGAGC 2: 155,937,995 (GRCm39) probably benign Het
Sertad4 T C 1: 192,529,486 (GRCm39) Y110C probably damaging Het
Setd1a GGTAGTGGT GGTAGTGGTAGTAGTGGT 7: 127,384,486 (GRCm39) probably benign Het
Smarca2 AGC AGCCCCGGC 19: 26,608,421 (GRCm39) probably benign Het
Smarca2 ACA ACAACAGCA 19: 26,608,386 (GRCm39) probably benign Het
Supt20 AGCA AGCACCCGCA 3: 54,635,083 (GRCm39) probably benign Het
Tcof1 AGC AGCCGC 18: 60,968,811 (GRCm39) probably benign Het
Tecpr1 A G 5: 144,154,204 (GRCm39) F83S probably damaging Het
Triobp GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA 15: 78,851,227 (GRCm39) probably benign Het
Vmn1r48 A T 6: 90,013,186 (GRCm39) M213K probably benign Het
Zc3h4 CCC CCCTGACATGCATCC 7: 16,163,612 (GRCm39) probably benign Het
Zscan29 T C 2: 120,994,477 (GRCm39) N503D possibly damaging Het
Other mutations in Cul1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Cul1 APN 6 47,485,978 (GRCm39) missense probably benign
IGL02410:Cul1 APN 6 47,461,948 (GRCm39) missense probably damaging 1.00
IGL02458:Cul1 APN 6 47,502,542 (GRCm39) missense possibly damaging 0.91
IGL02490:Cul1 APN 6 47,491,820 (GRCm39) missense probably damaging 0.98
IGL03065:Cul1 APN 6 47,472,015 (GRCm39) missense probably damaging 1.00
IGL03387:Cul1 APN 6 47,478,143 (GRCm39) missense probably damaging 0.96
IGL02837:Cul1 UTSW 6 47,500,139 (GRCm39) missense probably benign 0.01
R0064:Cul1 UTSW 6 47,479,349 (GRCm39) splice site probably benign
R0064:Cul1 UTSW 6 47,479,349 (GRCm39) splice site probably benign
R0436:Cul1 UTSW 6 47,500,707 (GRCm39) missense probably benign 0.16
R0746:Cul1 UTSW 6 47,495,222 (GRCm39) splice site probably null
R1103:Cul1 UTSW 6 47,494,111 (GRCm39) missense probably benign 0.03
R1471:Cul1 UTSW 6 47,491,820 (GRCm39) missense probably damaging 0.98
R1746:Cul1 UTSW 6 47,485,179 (GRCm39) missense probably damaging 0.98
R1852:Cul1 UTSW 6 47,497,764 (GRCm39) missense probably damaging 0.99
R1858:Cul1 UTSW 6 47,502,458 (GRCm39) splice site probably null
R1937:Cul1 UTSW 6 47,485,289 (GRCm39) missense probably benign 0.19
R1964:Cul1 UTSW 6 47,479,505 (GRCm39) missense probably damaging 0.98
R2985:Cul1 UTSW 6 47,479,441 (GRCm39) missense probably damaging 1.00
R4452:Cul1 UTSW 6 47,485,923 (GRCm39) nonsense probably null
R4653:Cul1 UTSW 6 47,461,897 (GRCm39) missense probably damaging 1.00
R4860:Cul1 UTSW 6 47,494,080 (GRCm39) missense probably benign 0.38
R4860:Cul1 UTSW 6 47,494,080 (GRCm39) missense probably benign 0.38
R4860:Cul1 UTSW 6 47,494,125 (GRCm39) missense probably damaging 0.99
R4860:Cul1 UTSW 6 47,494,125 (GRCm39) missense probably damaging 0.99
R5141:Cul1 UTSW 6 47,497,773 (GRCm39) missense probably benign 0.04
R5328:Cul1 UTSW 6 47,485,251 (GRCm39) missense probably damaging 0.99
R5399:Cul1 UTSW 6 47,462,018 (GRCm39) splice site probably null
R5593:Cul1 UTSW 6 47,491,925 (GRCm39) missense probably damaging 0.99
R5593:Cul1 UTSW 6 47,462,020 (GRCm39) nonsense probably null
R5616:Cul1 UTSW 6 47,500,722 (GRCm39) missense probably damaging 1.00
R5855:Cul1 UTSW 6 47,500,147 (GRCm39) missense probably benign 0.00
R6382:Cul1 UTSW 6 47,479,373 (GRCm39) missense probably damaging 1.00
R6670:Cul1 UTSW 6 47,494,068 (GRCm39) missense probably damaging 1.00
R6964:Cul1 UTSW 6 47,493,443 (GRCm39) missense probably benign 0.01
R8146:Cul1 UTSW 6 47,472,027 (GRCm39) missense possibly damaging 0.50
R8373:Cul1 UTSW 6 47,491,997 (GRCm39) missense possibly damaging 0.78
R8842:Cul1 UTSW 6 47,492,010 (GRCm39) missense probably damaging 1.00
R8899:Cul1 UTSW 6 47,474,246 (GRCm39) missense possibly damaging 0.84
R9093:Cul1 UTSW 6 47,495,173 (GRCm39) missense probably damaging 1.00
R9352:Cul1 UTSW 6 47,479,426 (GRCm39) missense probably benign 0.00
RF055:Cul1 UTSW 6 47,494,067 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTACCCTAGCATGGAAGTTG -3'
(R):5'- CTGTGACGTACTCCTCATCAG -3'

Sequencing Primer
(F):5'- TACCCTAGCATGGAAGTTGAGTATG -3'
(R):5'- GTGACGTACTCCTCATCAGAATATC -3'
Posted On 2019-12-04