Incidental Mutation 'RF001:Grin2b'
ID602499
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Nameglutamate receptor, ionotropic, NMDA2B (epsilon 2)
SynonymsGluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF001 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location135713233-136173511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136044240 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 21 (V21A)
Ref Sequence ENSEMBL: ENSMUSP00000142696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905] [ENSMUST00000125905] [ENSMUST00000143943] [ENSMUST00000152012] [ENSMUST00000188999]
Predicted Effect probably benign
Transcript: ENSMUST00000053880
AA Change: V21A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: V21A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111905
AA Change: V21A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: V21A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125905
AA Change: V21A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000143943
AA Change: V21A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000152012
AA Change: V21A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142696
Gene: ENSMUSG00000030209
AA Change: V21A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 66 312 1.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188999
AA Change: V21A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik G GTGGCTGCTA 1: 82,913,590 probably benign Het
Acer1 A G 17: 56,958,909 V122A probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,921 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Atp13a1 C A 8: 69,800,070 A680D probably damaging Het
Blm CGCCTCCTCCTC CGCCTCCTCCTCAGCCTCCTCCTC 7: 80,512,903 probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTCCTCCTCCTCCTC 7: 80,512,906 probably benign Het
Blm CTCCTCC CTCCTCCTCCTCGTCCTCC 7: 80,512,927 probably benign Het
Cad GT G 5: 31,060,212 probably benign Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,141,276 probably benign Het
Casz1 CACA C 4: 148,952,304 probably benign Het
Cherp GACCTGGA G 8: 72,462,049 probably null Het
Chga AGC AGCTGC 12: 102,561,423 probably benign Het
Coq7 A G 7: 118,533,182 S24P probably benign Het
Cul1 T C 6: 47,524,581 V734A possibly damaging Het
Cyb5r4 GCCCAGGGATGTGACAGACACACT GCCCAGGGATGTGACAGACACACTCCCCAGGGATGTGACAGACACACT 9: 87,040,416 probably benign Het
Dgkz A T 2: 91,939,941 F521I possibly damaging Het
Fam171b GCAGCA GCAGCATCAGCA 2: 83,812,886 probably benign Het
Fat1 T G 8: 44,988,966 S1102A probably benign Het
Gab3 CTT CTTTTT X: 75,000,018 probably benign Het
Gm14412 T C 2: 177,317,101 I52V probably benign Het
Gm5346 T G 8: 43,626,905 D94A possibly damaging Het
Gm5414 T C 15: 101,627,953 E79G probably benign Het
Gpc5 G A 14: 115,417,178 S470N probably benign Het
Hecw1 C A 13: 14,297,424 C553F probably damaging Het
Hsd3b6 T A 3: 98,806,440 H181L probably benign Het
Il2 CCAGGTGCTGCTGC CC 3: 37,125,762 probably benign Het
Inpp5f G A 7: 128,695,083 G1053R probably damaging Het
Kcnma1 T G 14: 23,311,697 Y1142S probably damaging Het
Kctd8 T C 5: 69,110,432 K445R possibly damaging Het
Kmt2b CC CCTCCTTC 7: 30,586,382 probably benign Het
Kmt2c TG TGTTGCGG 5: 25,315,775 probably benign Het
Krtap28-10 CACAGCCACAGCCACCACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCACCACAGCCACAGCCAC 1: 83,042,255 probably benign Het
Krtap28-10 GCCACCACAGC GCCACCACAGCCACATCCACCACAGC 1: 83,042,280 probably benign Het
Krtap28-10 CACCAC CACCACCGCCACCGCAACCAC 1: 83,042,282 probably benign Het
Lama1 A G 17: 67,752,902 D662G Het
Lce1m AC ACTGCTGCTGCCCC 3: 93,018,152 probably benign Het
Lce1m GCTGCCACC GCTGCCACCACTCCTGCCACC 3: 93,018,269 probably benign Het
Lmo4 A C 3: 144,201,862 S63A possibly damaging Het
Lrrk2 T C 15: 91,736,633 I952T probably benign Het
Lyst T C 13: 13,635,841 F699L probably benign Het
Matn3 T A 12: 8,958,797 D303E probably benign Het
Me1 A G 9: 86,582,823 Y545H probably damaging Het
Mettl3 A T 14: 52,300,299 V68E probably benign Het
Mptx2 T C 1: 173,274,969 N51S probably benign Het
Mylk A G 16: 34,879,371 D368G probably benign Het
Myom2 T C 8: 15,081,418 V372A possibly damaging Het
Neb T C 2: 52,195,421 D5569G probably damaging Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGCGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,030 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Rbm12 CC CCGGGTATTGTGGGACCAGTTATTGCGGGAGC 2: 156,096,075 probably benign Het
Sertad4 T C 1: 192,847,178 Y110C probably damaging Het
Setd1a GGTAGTGGT GGTAGTGGTAGTAGTGGT 7: 127,785,314 probably benign Het
Smarca2 ACA ACAACAGCA 19: 26,630,986 probably benign Het
Smarca2 AGC AGCCCCGGC 19: 26,631,021 probably benign Het
Supt20 AGCA AGCACCCGCA 3: 54,727,662 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tecpr1 A G 5: 144,217,386 F83S probably damaging Het
Triobp GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA 15: 78,967,027 probably benign Het
Vmn1r48 A T 6: 90,036,204 M213K probably benign Het
Zc3h4 CCC CCCTGACATGCATCC 7: 16,429,687 probably benign Het
Zscan29 T C 2: 121,163,996 N503D possibly damaging Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135736331 missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135733570 missense probably damaging 1.00
IGL01401:Grin2b APN 6 135736363 missense probably damaging 1.00
IGL01523:Grin2b APN 6 136044265 missense probably null 0.99
IGL01719:Grin2b APN 6 135733381 missense probably damaging 0.97
IGL01907:Grin2b APN 6 135733740 missense probably damaging 1.00
IGL01996:Grin2b APN 6 135732586 missense probably damaging 1.00
IGL02309:Grin2b APN 6 135736472 missense probably damaging 1.00
IGL02312:Grin2b APN 6 135739090 missense probably damaging 1.00
IGL02409:Grin2b APN 6 136043908 missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135923391 missense probably damaging 1.00
IGL02535:Grin2b APN 6 135779369 missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135922998 missense probably damaging 1.00
IGL02702:Grin2b APN 6 135739132 missense probably damaging 0.99
IGL03001:Grin2b APN 6 135739115 missense probably damaging 1.00
IGL03274:Grin2b APN 6 135780255 missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0164:Grin2b UTSW 6 135778648 splice site probably benign
R0194:Grin2b UTSW 6 135779305 missense probably damaging 1.00
R0594:Grin2b UTSW 6 135733929 missense probably damaging 1.00
R1434:Grin2b UTSW 6 135843195 missense probably benign 0.04
R1928:Grin2b UTSW 6 136044046 missense probably damaging 1.00
R1942:Grin2b UTSW 6 135732732 missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136044211 missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135733245 missense probably damaging 1.00
R2020:Grin2b UTSW 6 135733896 missense probably benign 0.12
R2103:Grin2b UTSW 6 135780140 missense probably benign 0.02
R2127:Grin2b UTSW 6 135778700 missense probably benign 0.03
R2495:Grin2b UTSW 6 135733182 missense probably damaging 1.00
R2656:Grin2b UTSW 6 135733429 missense probably damaging 1.00
R2847:Grin2b UTSW 6 135740953 missense probably damaging 1.00
R2866:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R3196:Grin2b UTSW 6 135732455 small deletion probably benign
R3418:Grin2b UTSW 6 135843110 missense probably benign 0.02
R3808:Grin2b UTSW 6 135923271 missense probably damaging 0.99
R4028:Grin2b UTSW 6 135736435 missense probably damaging 1.00
R4602:Grin2b UTSW 6 135778741 missense probably damaging 1.00
R4624:Grin2b UTSW 6 135733825 missense probably damaging 0.99
R4677:Grin2b UTSW 6 135774872 missense probably benign 0.13
R4744:Grin2b UTSW 6 135778699 missense probably damaging 1.00
R5020:Grin2b UTSW 6 135733407 missense probably benign 0.01
R5051:Grin2b UTSW 6 135779395 missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135732441 missense probably benign 0.03
R5125:Grin2b UTSW 6 135923299 missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135779342 missense probably damaging 1.00
R5318:Grin2b UTSW 6 135733918 missense probably damaging 0.99
R5349:Grin2b UTSW 6 136044283 missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135732368 missense probably damaging 1.00
R5438:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5439:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5440:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5530:Grin2b UTSW 6 135733723 missense probably benign 0.00
R5603:Grin2b UTSW 6 135923397 missense probably damaging 1.00
R5657:Grin2b UTSW 6 135733087 missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135740964 missense probably benign 0.24
R5941:Grin2b UTSW 6 135736373 missense probably damaging 0.99
R6057:Grin2b UTSW 6 135733944 missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135923458 missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135772399 missense probably damaging 1.00
R6309:Grin2b UTSW 6 135733027 missense probably benign 0.00
R6316:Grin2b UTSW 6 135780279 missense probably benign 0.00
R6419:Grin2b UTSW 6 135740967 missense probably damaging 1.00
R6551:Grin2b UTSW 6 135733344 missense probably damaging 1.00
R6612:Grin2b UTSW 6 135740998 missense probably damaging 1.00
R6616:Grin2b UTSW 6 135732551 missense probably benign
R6647:Grin2b UTSW 6 135733110 missense probably damaging 1.00
R6806:Grin2b UTSW 6 135774828 missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135780200 missense probably benign
R7033:Grin2b UTSW 6 135923038 missense probably damaging 1.00
R7058:Grin2b UTSW 6 135780306 missense probably damaging 0.97
R7144:Grin2b UTSW 6 135733476 missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135732948 missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135780251 missense probably damaging 0.97
R7453:Grin2b UTSW 6 135740949 missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135772396 missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135779303 missense probably damaging 0.99
R7615:Grin2b UTSW 6 135923364 missense probably damaging 1.00
R7632:Grin2b UTSW 6 135732555 missense probably benign 0.02
R7779:Grin2b UTSW 6 135778794 nonsense probably null
R8058:Grin2b UTSW 6 135733227 missense probably damaging 1.00
R8084:Grin2b UTSW 6 135733488 missense probably benign 0.03
R8145:Grin2b UTSW 6 135732499 missense probably benign 0.01
R8308:Grin2b UTSW 6 135923076 missense probably damaging 0.99
R8357:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8379:Grin2b UTSW 6 135922969 missense probably damaging 1.00
R8429:Grin2b UTSW 6 135733916 missense probably damaging 1.00
R8457:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8746:Grin2b UTSW 6 135922987 missense probably benign 0.02
R8925:Grin2b UTSW 6 135772341 missense probably damaging 0.97
R8927:Grin2b UTSW 6 135772341 missense probably damaging 0.97
R8963:Grin2b UTSW 6 136044009 missense probably damaging 1.00
R9075:Grin2b UTSW 6 135732511 frame shift probably null
R9076:Grin2b UTSW 6 135732511 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCGGTCAGACATAAGATCGCAG -3'
(R):5'- CGAGTTTCATGAACCGCAGAC -3'

Sequencing Primer
(F):5'- CAGATGCGGGTGATTATGCTC -3'
(R):5'- TTCAAGGATGCGTTCCAC -3'
Posted On2019-12-04