Incidental Mutation 'RF001:Zc3h4'
ID602500
Institutional Source Beutler Lab
Gene Symbol Zc3h4
Ensembl Gene ENSMUSG00000059273
Gene Namezinc finger CCCH-type containing 4
SynonymsLOC330474, Kiaa1064-hp, Bwq1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF001 (G1)
Quality Score156.476
Status Not validated
Chromosome7
Chromosomal Location16400910-16437696 bp(+) (GRCm38)
Type of Mutationsmall insertion (4 aa in frame mutation)
DNA Base Change (assembly) CCC to CCCTGACATGCATCC at 16429687 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098789] [ENSMUST00000209289]
Predicted Effect probably benign
Transcript: ENSMUST00000098789
SMART Domains Protein: ENSMUSP00000096386
Gene: ENSMUSG00000059273

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 35 97 N/A INTRINSIC
low complexity region 144 170 N/A INTRINSIC
low complexity region 184 247 N/A INTRINSIC
low complexity region 264 324 N/A INTRINSIC
ZnF_C3H1 341 366 1.95e-3 SMART
ZnF_C3H1 370 395 6.17e-6 SMART
ZnF_C3H1 396 419 3.38e-1 SMART
low complexity region 433 451 N/A INTRINSIC
low complexity region 456 486 N/A INTRINSIC
low complexity region 489 505 N/A INTRINSIC
low complexity region 552 641 N/A INTRINSIC
low complexity region 705 720 N/A INTRINSIC
coiled coil region 729 760 N/A INTRINSIC
internal_repeat_2 767 822 3.38e-5 PROSPERO
low complexity region 837 850 N/A INTRINSIC
low complexity region 863 880 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
internal_repeat_2 986 1037 3.38e-5 PROSPERO
low complexity region 1049 1072 N/A INTRINSIC
low complexity region 1077 1097 N/A INTRINSIC
low complexity region 1175 1195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209289
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of CCCH (C-x8-C-x5-C-x3-H type) zinc finger domain-containing proteins. These zinc finger domains, which coordinate zinc finger binding and are characterized by three cysteine residues and one histidine residue, are nucleic acid-binding. Other family members are known to function in post-transcriptional regulation. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik G GTGGCTGCTA 1: 82,913,590 probably benign Het
Acer1 A G 17: 56,958,909 V122A probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,921 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Atp13a1 C A 8: 69,800,070 A680D probably damaging Het
Blm CGCCTCCTCCTC CGCCTCCTCCTCAGCCTCCTCCTC 7: 80,512,903 probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTCCTCCTCCTCCTC 7: 80,512,906 probably benign Het
Blm CTCCTCC CTCCTCCTCCTCGTCCTCC 7: 80,512,927 probably benign Het
Cad GT G 5: 31,060,212 probably benign Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,141,276 probably benign Het
Casz1 CACA C 4: 148,952,304 probably benign Het
Cherp GACCTGGA G 8: 72,462,049 probably null Het
Chga AGC AGCTGC 12: 102,561,423 probably benign Het
Coq7 A G 7: 118,533,182 S24P probably benign Het
Cul1 T C 6: 47,524,581 V734A possibly damaging Het
Cyb5r4 GCCCAGGGATGTGACAGACACACT GCCCAGGGATGTGACAGACACACTCCCCAGGGATGTGACAGACACACT 9: 87,040,416 probably benign Het
Dgkz A T 2: 91,939,941 F521I possibly damaging Het
Fam171b GCAGCA GCAGCATCAGCA 2: 83,812,886 probably benign Het
Fat1 T G 8: 44,988,966 S1102A probably benign Het
Gab3 CTT CTTTTT X: 75,000,018 probably benign Het
Gm14412 T C 2: 177,317,101 I52V probably benign Het
Gm5346 T G 8: 43,626,905 D94A possibly damaging Het
Gm5414 T C 15: 101,627,953 E79G probably benign Het
Gpc5 G A 14: 115,417,178 S470N probably benign Het
Grin2b A G 6: 136,044,240 V21A probably benign Het
Hecw1 C A 13: 14,297,424 C553F probably damaging Het
Hsd3b6 T A 3: 98,806,440 H181L probably benign Het
Il2 CCAGGTGCTGCTGC CC 3: 37,125,762 probably benign Het
Inpp5f G A 7: 128,695,083 G1053R probably damaging Het
Kcnma1 T G 14: 23,311,697 Y1142S probably damaging Het
Kctd8 T C 5: 69,110,432 K445R possibly damaging Het
Kmt2b CC CCTCCTTC 7: 30,586,382 probably benign Het
Kmt2c TG TGTTGCGG 5: 25,315,775 probably benign Het
Krtap28-10 CACAGCCACAGCCACCACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCACCACAGCCACAGCCAC 1: 83,042,255 probably benign Het
Krtap28-10 GCCACCACAGC GCCACCACAGCCACATCCACCACAGC 1: 83,042,280 probably benign Het
Krtap28-10 CACCAC CACCACCGCCACCGCAACCAC 1: 83,042,282 probably benign Het
Lama1 A G 17: 67,752,902 D662G Het
Lce1m AC ACTGCTGCTGCCCC 3: 93,018,152 probably benign Het
Lce1m GCTGCCACC GCTGCCACCACTCCTGCCACC 3: 93,018,269 probably benign Het
Lmo4 A C 3: 144,201,862 S63A possibly damaging Het
Lrrk2 T C 15: 91,736,633 I952T probably benign Het
Lyst T C 13: 13,635,841 F699L probably benign Het
Matn3 T A 12: 8,958,797 D303E probably benign Het
Me1 A G 9: 86,582,823 Y545H probably damaging Het
Mettl3 A T 14: 52,300,299 V68E probably benign Het
Mptx2 T C 1: 173,274,969 N51S probably benign Het
Mylk A G 16: 34,879,371 D368G probably benign Het
Myom2 T C 8: 15,081,418 V372A possibly damaging Het
Neb T C 2: 52,195,421 D5569G probably damaging Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGCGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,030 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Rbm12 CC CCGGGTATTGTGGGACCAGTTATTGCGGGAGC 2: 156,096,075 probably benign Het
Sertad4 T C 1: 192,847,178 Y110C probably damaging Het
Setd1a GGTAGTGGT GGTAGTGGTAGTAGTGGT 7: 127,785,314 probably benign Het
Smarca2 ACA ACAACAGCA 19: 26,630,986 probably benign Het
Smarca2 AGC AGCCCCGGC 19: 26,631,021 probably benign Het
Supt20 AGCA AGCACCCGCA 3: 54,727,662 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tecpr1 A G 5: 144,217,386 F83S probably damaging Het
Triobp GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA 15: 78,967,027 probably benign Het
Vmn1r48 A T 6: 90,036,204 M213K probably benign Het
Zscan29 T C 2: 121,163,996 N503D possibly damaging Het
Other mutations in Zc3h4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Zc3h4 APN 7 16422234 missense unknown
IGL00923:Zc3h4 APN 7 16429692 missense unknown
IGL01541:Zc3h4 APN 7 16434332 missense unknown
IGL02115:Zc3h4 APN 7 16425783 missense unknown
IGL02303:Zc3h4 APN 7 16434077 missense unknown
IGL02336:Zc3h4 APN 7 16425777 missense unknown
IGL02734:Zc3h4 APN 7 16423924 missense unknown
IGL02736:Zc3h4 APN 7 16417383 nonsense probably null
BB008:Zc3h4 UTSW 7 16432984 missense unknown
BB018:Zc3h4 UTSW 7 16432984 missense unknown
R0032:Zc3h4 UTSW 7 16434640 missense unknown
R0032:Zc3h4 UTSW 7 16434640 missense unknown
R0220:Zc3h4 UTSW 7 16429273 missense unknown
R0336:Zc3h4 UTSW 7 16435178 missense unknown
R0416:Zc3h4 UTSW 7 16420275 missense probably damaging 1.00
R0666:Zc3h4 UTSW 7 16434772 missense unknown
R0864:Zc3h4 UTSW 7 16420179 missense probably damaging 0.99
R1068:Zc3h4 UTSW 7 16429236 missense unknown
R1145:Zc3h4 UTSW 7 16416913 missense possibly damaging 0.53
R1145:Zc3h4 UTSW 7 16416913 missense possibly damaging 0.53
R1472:Zc3h4 UTSW 7 16434770 missense unknown
R1665:Zc3h4 UTSW 7 16429580 missense unknown
R2087:Zc3h4 UTSW 7 16416940 missense possibly damaging 0.72
R2182:Zc3h4 UTSW 7 16422516 missense unknown
R2508:Zc3h4 UTSW 7 16434339 missense unknown
R3037:Zc3h4 UTSW 7 16421485 missense unknown
R4439:Zc3h4 UTSW 7 16429111 missense unknown
R4576:Zc3h4 UTSW 7 16434654 missense unknown
R5030:Zc3h4 UTSW 7 16422230 missense unknown
R5160:Zc3h4 UTSW 7 16434648 missense unknown
R5270:Zc3h4 UTSW 7 16434515 missense unknown
R5490:Zc3h4 UTSW 7 16429005 missense unknown
R5519:Zc3h4 UTSW 7 16435232 missense unknown
R5770:Zc3h4 UTSW 7 16429611 missense unknown
R7067:Zc3h4 UTSW 7 16429051 nonsense probably null
R7234:Zc3h4 UTSW 7 16429036 missense unknown
R7316:Zc3h4 UTSW 7 16435335 missense unknown
R7771:Zc3h4 UTSW 7 16429899 missense unknown
R7852:Zc3h4 UTSW 7 16422467 missense unknown
R7931:Zc3h4 UTSW 7 16432984 missense unknown
RF039:Zc3h4 UTSW 7 16429618 small deletion probably benign
X0064:Zc3h4 UTSW 7 16422516 missense unknown
Predicted Primers PCR Primer
(F):5'- GAGCTGCTGCCTTTCCTTAG -3'
(R):5'- ACCAGGCTCCATTTCCATGC -3'

Sequencing Primer
(F):5'- TCCTTAGCAGCTTCATCACAAG -3'
(R):5'- CCTCTTGCTGCGGGTAGAAG -3'
Posted On2019-12-04