Incidental Mutation 'RF001:Kmt2b'
ID 602501
Institutional Source Beutler Lab
Gene Symbol Kmt2b
Ensembl Gene ENSMUSG00000006307
Gene Name lysine (K)-specific methyltransferase 2B
Synonyms 2610014H22Rik, Mll2, Wbp7
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF001 (G1)
Quality Score 217.471
Status Not validated
Chromosome 7
Chromosomal Location 30268283-30288151 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) CC to CCTCCTTC at 30285807 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000006470] [ENSMUST00000108150] [ENSMUST00000108151] [ENSMUST00000108154]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006470
SMART Domains Protein: ENSMUSP00000006470
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 7.2e-15 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1881 1899 N/A INTRINSIC
low complexity region 1912 1942 N/A INTRINSIC
low complexity region 1961 1978 N/A INTRINSIC
low complexity region 1991 2003 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2048 2061 N/A INTRINSIC
low complexity region 2087 2105 N/A INTRINSIC
low complexity region 2127 2138 N/A INTRINSIC
low complexity region 2215 2235 N/A INTRINSIC
low complexity region 2239 2270 N/A INTRINSIC
low complexity region 2396 2406 N/A INTRINSIC
FYRC 2419 2504 4.83e-36 SMART
SET 2581 2703 1.67e-42 SMART
PostSET 2705 2721 4.65e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108150
SMART Domains Protein: ENSMUSP00000103785
Gene: ENSMUSG00000006310

DomainStartEndE-ValueType
ZnF_C2H2 14 36 1.67e-2 SMART
ZnF_C2H2 41 63 2.4e-3 SMART
low complexity region 81 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108151
SMART Domains Protein: ENSMUSP00000103786
Gene: ENSMUSG00000006310

DomainStartEndE-ValueType
BTB 29 117 1.67e-8 SMART
low complexity region 207 222 N/A INTRINSIC
ZnF_C2H2 350 372 1.28e-3 SMART
ZnF_C2H2 378 400 1.67e-2 SMART
ZnF_C2H2 405 427 2.4e-3 SMART
low complexity region 445 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108154
SMART Domains Protein: ENSMUSP00000103789
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 1e-14 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1872 1890 N/A INTRINSIC
low complexity region 1903 1933 N/A INTRINSIC
low complexity region 1952 1969 N/A INTRINSIC
low complexity region 1982 1994 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2039 2052 N/A INTRINSIC
low complexity region 2078 2096 N/A INTRINSIC
low complexity region 2118 2129 N/A INTRINSIC
low complexity region 2206 2226 N/A INTRINSIC
low complexity region 2230 2261 N/A INTRINSIC
low complexity region 2383 2398 N/A INTRINSIC
FYRC 2411 2496 4.83e-36 SMART
SET 2573 2695 1.67e-42 SMART
PostSET 2697 2713 4.65e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131002
SMART Domains Protein: ENSMUSP00000118486
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 30 69 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Pfam:zf-CXXC 255 302 5.2e-15 PFAM
low complexity region 331 353 N/A INTRINSIC
low complexity region 395 407 N/A INTRINSIC
PHD 501 548 1.25e-5 SMART
PHD 549 599 5.4e-10 SMART
PHD 635 692 1.27e-6 SMART
low complexity region 707 719 N/A INTRINSIC
PHD 938 984 3.82e-1 SMART
FYRN 1037 1080 3.25e-19 SMART
low complexity region 1173 1191 N/A INTRINSIC
low complexity region 1204 1234 N/A INTRINSIC
low complexity region 1253 1270 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
low complexity region 1305 1318 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1379 1397 N/A INTRINSIC
low complexity region 1419 1430 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
low complexity region 1531 1562 N/A INTRINSIC
low complexity region 1684 1699 N/A INTRINSIC
FYRC 1712 1797 4.83e-36 SMART
SET 1874 1996 1.67e-42 SMART
PostSET 1998 2014 4.65e-4 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains multiple domains including a CXXC zinc finger, three PHD zinc fingers, two FY-rich domains, and a SET (suppressor of variegation, enhancer of zeste, and trithorax) domain. The SET domain is a conserved C-terminal domain that characterizes proteins of the MLL (mixed-lineage leukemia) family. This gene is ubiquitously expressed in adult tissues. It is also amplified in solid tumor cell lines, and may be involved in human cancer. Two alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene, however, the full length nature of the shorter transcript is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic growth retardation, abnormal somite development, neural tube defects, increased apoptosis, and complete embryonic lethality. Homozygotes for a hypomorphic allele show embryonic growth arrest, altered DNA methylation, and reduced female fertility. [provided by MGI curators]
Allele List at MGI

 All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik G GTGGCTGCTA 1: 82,891,311 (GRCm39) probably benign Het
Acer1 A G 17: 57,265,909 (GRCm39) V122A probably benign Het
Adam34l T G 8: 44,079,942 (GRCm39) D94A possibly damaging Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,693,974 (GRCm39) probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,479,405 (GRCm39) probably benign Het
Atp13a1 C A 8: 70,252,720 (GRCm39) A680D probably damaging Het
Blm CGCCTCCTCCTC CGCCTCCTCCTCAGCCTCCTCCTC 7: 80,162,651 (GRCm39) probably benign Het
Blm CTCCTCC CTCCTCCTCCTCGTCCTCC 7: 80,162,675 (GRCm39) probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTCCTCCTCCTCCTC 7: 80,162,654 (GRCm39) probably benign Het
Cad GT G 5: 31,217,556 (GRCm39) probably benign Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,129,715 (GRCm39) probably benign Het
Casz1 CACA C 4: 149,036,761 (GRCm39) probably benign Het
Cherp GACCTGGA G 8: 73,215,893 (GRCm39) probably null Het
Chga AGC AGCTGC 12: 102,527,682 (GRCm39) probably benign Het
Coq7 A G 7: 118,132,405 (GRCm39) S24P probably benign Het
Cul1 T C 6: 47,501,515 (GRCm39) V734A possibly damaging Het
Cyb5r4 GCCCAGGGATGTGACAGACACACT GCCCAGGGATGTGACAGACACACTCCCCAGGGATGTGACAGACACACT 9: 86,922,469 (GRCm39) probably benign Het
Dgkz A T 2: 91,770,286 (GRCm39) F521I possibly damaging Het
Fam171b GCAGCA GCAGCATCAGCA 2: 83,643,230 (GRCm39) probably benign Het
Fat1 T G 8: 45,442,003 (GRCm39) S1102A probably benign Het
Gab3 CTT CTTTTT X: 74,043,624 (GRCm39) probably benign Het
Gm14412 T C 2: 177,008,894 (GRCm39) I52V probably benign Het
Gm5414 T C 15: 101,536,388 (GRCm39) E79G probably benign Het
Gpc5 G A 14: 115,654,590 (GRCm39) S470N probably benign Het
Grin2b A G 6: 136,021,238 (GRCm39) V21A probably benign Het
Hecw1 C A 13: 14,472,009 (GRCm39) C553F probably damaging Het
Hsd3b6 T A 3: 98,713,756 (GRCm39) H181L probably benign Het
Il2 CCAGGTGCTGCTGC CC 3: 37,179,911 (GRCm39) probably benign Het
Inpp5f G A 7: 128,296,807 (GRCm39) G1053R probably damaging Het
Kcnma1 T G 14: 23,361,765 (GRCm39) Y1142S probably damaging Het
Kctd8 T C 5: 69,267,775 (GRCm39) K445R possibly damaging Het
Kmt2c TG TGTTGCGG 5: 25,520,773 (GRCm39) probably benign Het
Krtap28-10 CACCAC CACCACCGCCACCGCAACCAC 1: 83,020,003 (GRCm39) probably benign Het
Krtap28-10 CACAGCCACAGCCACCACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCACCACAGCCACAGCCAC 1: 83,019,976 (GRCm39) probably benign Het
Krtap28-10 GCCACCACAGC GCCACCACAGCCACATCCACCACAGC 1: 83,020,001 (GRCm39) probably benign Het
Lama1 A G 17: 68,059,897 (GRCm39) D662G Het
Lce1m AC ACTGCTGCTGCCCC 3: 92,925,459 (GRCm39) probably benign Het
Lce1m GCTGCCACC GCTGCCACCACTCCTGCCACC 3: 92,925,576 (GRCm39) probably benign Het
Lmo4 A C 3: 143,907,623 (GRCm39) S63A possibly damaging Het
Lrrk2 T C 15: 91,620,836 (GRCm39) I952T probably benign Het
Lyst T C 13: 13,810,426 (GRCm39) F699L probably benign Het
Matn3 T A 12: 9,008,797 (GRCm39) D303E probably benign Het
Me1 A G 9: 86,464,876 (GRCm39) Y545H probably damaging Het
Mettl3 A T 14: 52,537,756 (GRCm39) V68E probably benign Het
Mptx2 T C 1: 173,102,536 (GRCm39) N51S probably benign Het
Mylk A G 16: 34,699,741 (GRCm39) D368G probably benign Het
Myom2 T C 8: 15,131,418 (GRCm39) V372A possibly damaging Het
Neb T C 2: 52,085,433 (GRCm39) D5569G probably damaging Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGCGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,030 (GRCm39) probably benign Het
P4ha2 CCAGGTG C 11: 54,001,061 (GRCm39) probably benign Het
Pop1 G A 15: 34,502,583 (GRCm39) G90D probably damaging Het
Rbm12 CC CCGGGTATTGTGGGACCAGTTATTGCGGGAGC 2: 155,937,995 (GRCm39) probably benign Het
Sertad4 T C 1: 192,529,486 (GRCm39) Y110C probably damaging Het
Setd1a GGTAGTGGT GGTAGTGGTAGTAGTGGT 7: 127,384,486 (GRCm39) probably benign Het
Smarca2 AGC AGCCCCGGC 19: 26,608,421 (GRCm39) probably benign Het
Smarca2 ACA ACAACAGCA 19: 26,608,386 (GRCm39) probably benign Het
Supt20 AGCA AGCACCCGCA 3: 54,635,083 (GRCm39) probably benign Het
Tcof1 AGC AGCCGC 18: 60,968,811 (GRCm39) probably benign Het
Tecpr1 A G 5: 144,154,204 (GRCm39) F83S probably damaging Het
Triobp GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA 15: 78,851,227 (GRCm39) probably benign Het
Vmn1r48 A T 6: 90,013,186 (GRCm39) M213K probably benign Het
Zc3h4 CCC CCCTGACATGCATCC 7: 16,163,612 (GRCm39) probably benign Het
Zscan29 T C 2: 120,994,477 (GRCm39) N503D possibly damaging Het
Other mutations in Kmt2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Kmt2b APN 7 30,285,938 (GRCm39) unclassified probably benign
IGL00821:Kmt2b APN 7 30,270,038 (GRCm39) missense probably damaging 1.00
IGL00985:Kmt2b APN 7 30,279,352 (GRCm39) missense probably damaging 1.00
IGL01092:Kmt2b APN 7 30,279,932 (GRCm39) missense probably damaging 1.00
IGL01933:Kmt2b APN 7 30,268,939 (GRCm39) critical splice donor site probably null
IGL01949:Kmt2b APN 7 30,276,586 (GRCm39) splice site probably null
IGL02253:Kmt2b APN 7 30,281,152 (GRCm39) missense probably damaging 1.00
IGL02455:Kmt2b APN 7 30,278,303 (GRCm39) critical splice donor site probably null
IGL02493:Kmt2b APN 7 30,268,936 (GRCm39) unclassified probably benign
IGL02504:Kmt2b APN 7 30,285,968 (GRCm39) unclassified probably benign
IGL02532:Kmt2b APN 7 30,286,314 (GRCm39) unclassified probably benign
IGL02698:Kmt2b APN 7 30,278,118 (GRCm39) splice site probably benign
IGL02717:Kmt2b APN 7 30,282,869 (GRCm39) missense probably damaging 1.00
IGL02826:Kmt2b APN 7 30,276,569 (GRCm39) missense probably damaging 1.00
IGL02966:Kmt2b APN 7 30,274,887 (GRCm39) missense probably benign 0.02
IGL03386:Kmt2b APN 7 30,273,396 (GRCm39) missense possibly damaging 0.94
Dean UTSW 7 30,268,835 (GRCm39) missense possibly damaging 0.83
provost UTSW 7 30,281,633 (GRCm39) missense probably damaging 1.00
tenure UTSW 7 30,268,600 (GRCm39) missense probably damaging 1.00
3-1:Kmt2b UTSW 7 30,269,040 (GRCm39) nonsense probably null
FR4304:Kmt2b UTSW 7 30,285,788 (GRCm39) unclassified probably benign
FR4340:Kmt2b UTSW 7 30,285,800 (GRCm39) unclassified probably benign
FR4340:Kmt2b UTSW 7 30,285,794 (GRCm39) unclassified probably benign
FR4340:Kmt2b UTSW 7 30,285,788 (GRCm39) unclassified probably benign
FR4342:Kmt2b UTSW 7 30,285,800 (GRCm39) unclassified probably benign
FR4449:Kmt2b UTSW 7 30,285,794 (GRCm39) unclassified probably benign
FR4449:Kmt2b UTSW 7 30,285,791 (GRCm39) unclassified probably benign
FR4449:Kmt2b UTSW 7 30,285,786 (GRCm39) unclassified probably benign
FR4548:Kmt2b UTSW 7 30,285,805 (GRCm39) unclassified probably benign
FR4589:Kmt2b UTSW 7 30,285,806 (GRCm39) unclassified probably benign
FR4589:Kmt2b UTSW 7 30,285,789 (GRCm39) nonsense probably null
FR4589:Kmt2b UTSW 7 30,285,786 (GRCm39) unclassified probably benign
FR4737:Kmt2b UTSW 7 30,285,795 (GRCm39) unclassified probably benign
FR4737:Kmt2b UTSW 7 30,285,792 (GRCm39) unclassified probably benign
FR4737:Kmt2b UTSW 7 30,285,791 (GRCm39) unclassified probably benign
FR4737:Kmt2b UTSW 7 30,285,803 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,787 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,785 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,798 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,791 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,789 (GRCm39) nonsense probably null
PIT4403001:Kmt2b UTSW 7 30,285,114 (GRCm39) missense probably damaging 1.00
PIT4802001:Kmt2b UTSW 7 30,278,996 (GRCm39) missense probably damaging 0.99
R0057:Kmt2b UTSW 7 30,276,217 (GRCm39) splice site probably benign
R0131:Kmt2b UTSW 7 30,283,346 (GRCm39) missense probably damaging 0.99
R0241:Kmt2b UTSW 7 30,276,494 (GRCm39) missense probably damaging 1.00
R0241:Kmt2b UTSW 7 30,276,494 (GRCm39) missense probably damaging 1.00
R0377:Kmt2b UTSW 7 30,273,618 (GRCm39) missense probably damaging 1.00
R0396:Kmt2b UTSW 7 30,276,180 (GRCm39) missense probably damaging 1.00
R1241:Kmt2b UTSW 7 30,274,365 (GRCm39) missense probably damaging 0.98
R1252:Kmt2b UTSW 7 30,279,912 (GRCm39) missense probably damaging 0.99
R1418:Kmt2b UTSW 7 30,276,385 (GRCm39) splice site probably benign
R1599:Kmt2b UTSW 7 30,270,000 (GRCm39) missense probably damaging 1.00
R1632:Kmt2b UTSW 7 30,283,387 (GRCm39) missense probably damaging 1.00
R1745:Kmt2b UTSW 7 30,285,275 (GRCm39) missense possibly damaging 0.90
R1867:Kmt2b UTSW 7 30,274,083 (GRCm39) missense possibly damaging 0.71
R1955:Kmt2b UTSW 7 30,274,776 (GRCm39) missense possibly damaging 0.90
R2040:Kmt2b UTSW 7 30,268,845 (GRCm39) missense probably damaging 1.00
R2113:Kmt2b UTSW 7 30,282,812 (GRCm39) missense probably damaging 1.00
R2216:Kmt2b UTSW 7 30,273,490 (GRCm39) missense probably benign 0.25
R2401:Kmt2b UTSW 7 30,276,133 (GRCm39) missense probably damaging 1.00
R2518:Kmt2b UTSW 7 30,275,493 (GRCm39) missense probably benign 0.10
R3436:Kmt2b UTSW 7 30,276,117 (GRCm39) missense probably damaging 1.00
R4248:Kmt2b UTSW 7 30,273,489 (GRCm39) missense probably benign 0.25
R4259:Kmt2b UTSW 7 30,280,506 (GRCm39) missense probably damaging 0.99
R4290:Kmt2b UTSW 7 30,281,261 (GRCm39) critical splice donor site probably null
R4388:Kmt2b UTSW 7 30,288,015 (GRCm39) unclassified probably benign
R4542:Kmt2b UTSW 7 30,279,684 (GRCm39) missense probably damaging 0.99
R4649:Kmt2b UTSW 7 30,285,783 (GRCm39) unclassified probably benign
R4722:Kmt2b UTSW 7 30,282,627 (GRCm39) missense probably damaging 1.00
R4891:Kmt2b UTSW 7 30,276,186 (GRCm39) nonsense probably null
R4916:Kmt2b UTSW 7 30,277,942 (GRCm39) missense probably damaging 0.99
R5104:Kmt2b UTSW 7 30,269,265 (GRCm39) missense probably damaging 1.00
R5254:Kmt2b UTSW 7 30,268,600 (GRCm39) missense probably damaging 1.00
R5262:Kmt2b UTSW 7 30,269,219 (GRCm39) missense probably damaging 1.00
R5307:Kmt2b UTSW 7 30,281,098 (GRCm39) missense possibly damaging 0.91
R5526:Kmt2b UTSW 7 30,279,869 (GRCm39) missense probably damaging 1.00
R5609:Kmt2b UTSW 7 30,276,570 (GRCm39) missense probably damaging 0.99
R6150:Kmt2b UTSW 7 30,287,902 (GRCm39) unclassified probably benign
R6727:Kmt2b UTSW 7 30,283,984 (GRCm39) missense probably damaging 0.98
R6824:Kmt2b UTSW 7 30,285,701 (GRCm39) unclassified probably benign
R7048:Kmt2b UTSW 7 30,268,731 (GRCm39) missense probably damaging 0.99
R7155:Kmt2b UTSW 7 30,279,388 (GRCm39) missense probably damaging 0.99
R7307:Kmt2b UTSW 7 30,279,896 (GRCm39) missense probably damaging 0.99
R7388:Kmt2b UTSW 7 30,281,385 (GRCm39) missense probably damaging 1.00
R7555:Kmt2b UTSW 7 30,268,835 (GRCm39) missense possibly damaging 0.83
R7569:Kmt2b UTSW 7 30,268,978 (GRCm39) missense possibly damaging 0.54
R7616:Kmt2b UTSW 7 30,281,633 (GRCm39) missense probably damaging 1.00
R7669:Kmt2b UTSW 7 30,282,656 (GRCm39) missense possibly damaging 0.84
R7881:Kmt2b UTSW 7 30,279,208 (GRCm39) missense probably damaging 1.00
R7999:Kmt2b UTSW 7 30,276,199 (GRCm39) missense probably damaging 1.00
R8003:Kmt2b UTSW 7 30,268,802 (GRCm39) missense probably damaging 0.98
R8189:Kmt2b UTSW 7 30,268,756 (GRCm39) missense probably damaging 0.98
R8291:Kmt2b UTSW 7 30,284,894 (GRCm39) missense probably damaging 1.00
R8314:Kmt2b UTSW 7 30,278,347 (GRCm39) missense probably damaging 0.99
R8802:Kmt2b UTSW 7 30,283,496 (GRCm39) missense probably damaging 1.00
R8954:Kmt2b UTSW 7 30,273,640 (GRCm39) missense probably damaging 1.00
R9046:Kmt2b UTSW 7 30,285,479 (GRCm39) missense probably benign 0.00
R9225:Kmt2b UTSW 7 30,286,172 (GRCm39) missense unknown
R9258:Kmt2b UTSW 7 30,281,893 (GRCm39) missense probably null 0.99
R9414:Kmt2b UTSW 7 30,282,307 (GRCm39) missense probably damaging 0.99
R9468:Kmt2b UTSW 7 30,284,513 (GRCm39) missense probably damaging 0.98
R9508:Kmt2b UTSW 7 30,269,259 (GRCm39) missense probably damaging 0.99
R9642:Kmt2b UTSW 7 30,283,340 (GRCm39) critical splice donor site probably null
R9667:Kmt2b UTSW 7 30,287,784 (GRCm39) missense unknown
R9709:Kmt2b UTSW 7 30,279,228 (GRCm39) missense probably damaging 0.98
RF006:Kmt2b UTSW 7 30,285,802 (GRCm39) unclassified probably benign
RF020:Kmt2b UTSW 7 30,285,807 (GRCm39) unclassified probably benign
RF021:Kmt2b UTSW 7 30,285,782 (GRCm39) unclassified probably benign
RF030:Kmt2b UTSW 7 30,285,802 (GRCm39) unclassified probably benign
RF035:Kmt2b UTSW 7 30,285,782 (GRCm39) unclassified probably benign
X0067:Kmt2b UTSW 7 30,278,998 (GRCm39) missense probably damaging 0.99
Z1088:Kmt2b UTSW 7 30,284,676 (GRCm39) missense probably benign 0.28
Z1176:Kmt2b UTSW 7 30,276,795 (GRCm39) missense probably damaging 1.00
Z1177:Kmt2b UTSW 7 30,285,841 (GRCm39) missense unknown
Z1177:Kmt2b UTSW 7 30,283,588 (GRCm39) missense probably damaging 0.98
Z1177:Kmt2b UTSW 7 30,274,449 (GRCm39) missense probably benign 0.08
Z1186:Kmt2b UTSW 7 30,284,732 (GRCm39) missense probably benign
Z1186:Kmt2b UTSW 7 30,274,404 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCTTCCTAGAGCATGTAGC -3'
(R):5'- AAGTTTGTTTCCAAGGCCAAG -3'

Sequencing Primer
(F):5'- AGGAGACTCTTCCTGCTTCTCTG -3'
(R):5'- GTTTGTTTCCAAGGCCAAGAAAGTG -3'
Posted On 2019-12-04