Incidental Mutation 'RF001:Blm'
ID 602504
Institutional Source Beutler Lab
Gene Symbol Blm
Ensembl Gene ENSMUSG00000030528
Gene Name Bloom syndrome, RecQ like helicase
Synonyms
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF001 (G1)
Quality Score 217.468
Status Not validated
Chromosome 7
Chromosomal Location 80104741-80184896 bp(-) (GRCm39)
Type of Mutation small insertion (4 aa in frame mutation)
DNA Base Change (assembly) CTCCTCC to CTCCTCCTCCTCGTCCTCC at 80162675 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]
AlphaFold O88700
Predicted Effect probably benign
Transcript: ENSMUST00000081314
SMART Domains Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 219 231 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
Pfam:BDHCT 376 416 5.5e-27 PFAM
low complexity region 557 574 N/A INTRINSIC
DEXDc 672 873 1.59e-29 SMART
HELICc 910 992 1.29e-24 SMART
RQC 1084 1198 1.43e-15 SMART
HRDC 1217 1297 9.4e-20 SMART
low complexity region 1357 1371 N/A INTRINSIC
low complexity region 1378 1392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170315
SMART Domains Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528

DomainStartEndE-ValueType
Pfam:BLM_N 4 375 1.1e-161 PFAM
Pfam:BDHCT 380 419 6.4e-25 PFAM
Pfam:BDHCT_assoc 433 658 8.8e-108 PFAM
DEXDc 675 876 1.59e-29 SMART
HELICc 913 995 1.29e-24 SMART
Pfam:RecQ_Zn_bind 1006 1078 1.5e-19 PFAM
RQC 1087 1201 1.43e-15 SMART
HRDC 1220 1300 9.4e-20 SMART
low complexity region 1360 1374 N/A INTRINSIC
low complexity region 1381 1395 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik G GTGGCTGCTA 1: 82,891,311 (GRCm39) probably benign Het
Acer1 A G 17: 57,265,909 (GRCm39) V122A probably benign Het
Adam34l T G 8: 44,079,942 (GRCm39) D94A possibly damaging Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,693,974 (GRCm39) probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,479,405 (GRCm39) probably benign Het
Atp13a1 C A 8: 70,252,720 (GRCm39) A680D probably damaging Het
Cad GT G 5: 31,217,556 (GRCm39) probably benign Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,129,715 (GRCm39) probably benign Het
Casz1 CACA C 4: 149,036,761 (GRCm39) probably benign Het
Cherp GACCTGGA G 8: 73,215,893 (GRCm39) probably null Het
Chga AGC AGCTGC 12: 102,527,682 (GRCm39) probably benign Het
Coq7 A G 7: 118,132,405 (GRCm39) S24P probably benign Het
Cul1 T C 6: 47,501,515 (GRCm39) V734A possibly damaging Het
Cyb5r4 GCCCAGGGATGTGACAGACACACT GCCCAGGGATGTGACAGACACACTCCCCAGGGATGTGACAGACACACT 9: 86,922,469 (GRCm39) probably benign Het
Dgkz A T 2: 91,770,286 (GRCm39) F521I possibly damaging Het
Fam171b GCAGCA GCAGCATCAGCA 2: 83,643,230 (GRCm39) probably benign Het
Fat1 T G 8: 45,442,003 (GRCm39) S1102A probably benign Het
Gab3 CTT CTTTTT X: 74,043,624 (GRCm39) probably benign Het
Gm14412 T C 2: 177,008,894 (GRCm39) I52V probably benign Het
Gm5414 T C 15: 101,536,388 (GRCm39) E79G probably benign Het
Gpc5 G A 14: 115,654,590 (GRCm39) S470N probably benign Het
Grin2b A G 6: 136,021,238 (GRCm39) V21A probably benign Het
Hecw1 C A 13: 14,472,009 (GRCm39) C553F probably damaging Het
Hsd3b6 T A 3: 98,713,756 (GRCm39) H181L probably benign Het
Il2 CCAGGTGCTGCTGC CC 3: 37,179,911 (GRCm39) probably benign Het
Inpp5f G A 7: 128,296,807 (GRCm39) G1053R probably damaging Het
Kcnma1 T G 14: 23,361,765 (GRCm39) Y1142S probably damaging Het
Kctd8 T C 5: 69,267,775 (GRCm39) K445R possibly damaging Het
Kmt2b CC CCTCCTTC 7: 30,285,807 (GRCm39) probably benign Het
Kmt2c TG TGTTGCGG 5: 25,520,773 (GRCm39) probably benign Het
Krtap28-10 CACCAC CACCACCGCCACCGCAACCAC 1: 83,020,003 (GRCm39) probably benign Het
Krtap28-10 CACAGCCACAGCCACCACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCACCACAGCCACAGCCAC 1: 83,019,976 (GRCm39) probably benign Het
Krtap28-10 GCCACCACAGC GCCACCACAGCCACATCCACCACAGC 1: 83,020,001 (GRCm39) probably benign Het
Lama1 A G 17: 68,059,897 (GRCm39) D662G Het
Lce1m AC ACTGCTGCTGCCCC 3: 92,925,459 (GRCm39) probably benign Het
Lce1m GCTGCCACC GCTGCCACCACTCCTGCCACC 3: 92,925,576 (GRCm39) probably benign Het
Lmo4 A C 3: 143,907,623 (GRCm39) S63A possibly damaging Het
Lrrk2 T C 15: 91,620,836 (GRCm39) I952T probably benign Het
Lyst T C 13: 13,810,426 (GRCm39) F699L probably benign Het
Matn3 T A 12: 9,008,797 (GRCm39) D303E probably benign Het
Me1 A G 9: 86,464,876 (GRCm39) Y545H probably damaging Het
Mettl3 A T 14: 52,537,756 (GRCm39) V68E probably benign Het
Mptx2 T C 1: 173,102,536 (GRCm39) N51S probably benign Het
Mylk A G 16: 34,699,741 (GRCm39) D368G probably benign Het
Myom2 T C 8: 15,131,418 (GRCm39) V372A possibly damaging Het
Neb T C 2: 52,085,433 (GRCm39) D5569G probably damaging Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGCGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,030 (GRCm39) probably benign Het
P4ha2 CCAGGTG C 11: 54,001,061 (GRCm39) probably benign Het
Pop1 G A 15: 34,502,583 (GRCm39) G90D probably damaging Het
Rbm12 CC CCGGGTATTGTGGGACCAGTTATTGCGGGAGC 2: 155,937,995 (GRCm39) probably benign Het
Sertad4 T C 1: 192,529,486 (GRCm39) Y110C probably damaging Het
Setd1a GGTAGTGGT GGTAGTGGTAGTAGTGGT 7: 127,384,486 (GRCm39) probably benign Het
Smarca2 AGC AGCCCCGGC 19: 26,608,421 (GRCm39) probably benign Het
Smarca2 ACA ACAACAGCA 19: 26,608,386 (GRCm39) probably benign Het
Supt20 AGCA AGCACCCGCA 3: 54,635,083 (GRCm39) probably benign Het
Tcof1 AGC AGCCGC 18: 60,968,811 (GRCm39) probably benign Het
Tecpr1 A G 5: 144,154,204 (GRCm39) F83S probably damaging Het
Triobp GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA 15: 78,851,227 (GRCm39) probably benign Het
Vmn1r48 A T 6: 90,013,186 (GRCm39) M213K probably benign Het
Zc3h4 CCC CCCTGACATGCATCC 7: 16,163,612 (GRCm39) probably benign Het
Zscan29 T C 2: 120,994,477 (GRCm39) N503D possibly damaging Het
Other mutations in Blm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Blm APN 7 80,123,819 (GRCm39) missense probably damaging 1.00
IGL01658:Blm APN 7 80,113,689 (GRCm39) missense probably damaging 0.98
IGL02048:Blm APN 7 80,152,709 (GRCm39) splice site probably benign
IGL02060:Blm APN 7 80,164,328 (GRCm39) splice site probably benign
IGL02063:Blm APN 7 80,159,167 (GRCm39) nonsense probably null
IGL02102:Blm APN 7 80,119,504 (GRCm39) missense probably damaging 1.00
IGL02420:Blm APN 7 80,145,754 (GRCm39) missense probably damaging 1.00
IGL02452:Blm APN 7 80,153,125 (GRCm39) splice site probably null
IGL02566:Blm APN 7 80,123,944 (GRCm39) missense probably damaging 1.00
IGL03387:Blm APN 7 80,143,895 (GRCm39) missense probably damaging 1.00
FR4304:Blm UTSW 7 80,162,667 (GRCm39) small insertion probably benign
FR4304:Blm UTSW 7 80,113,521 (GRCm39) frame shift probably null
FR4340:Blm UTSW 7 80,162,658 (GRCm39) small insertion probably benign
FR4340:Blm UTSW 7 80,162,655 (GRCm39) small insertion probably benign
FR4340:Blm UTSW 7 80,113,515 (GRCm39) unclassified probably benign
FR4449:Blm UTSW 7 80,162,656 (GRCm39) small insertion probably benign
FR4548:Blm UTSW 7 80,113,517 (GRCm39) frame shift probably null
FR4589:Blm UTSW 7 80,113,518 (GRCm39) frame shift probably null
FR4737:Blm UTSW 7 80,113,522 (GRCm39) frame shift probably null
FR4737:Blm UTSW 7 80,113,519 (GRCm39) frame shift probably null
FR4976:Blm UTSW 7 80,162,655 (GRCm39) small insertion probably benign
FR4976:Blm UTSW 7 80,113,515 (GRCm39) unclassified probably benign
R0133:Blm UTSW 7 80,152,115 (GRCm39) missense possibly damaging 0.93
R0194:Blm UTSW 7 80,114,694 (GRCm39) unclassified probably benign
R0526:Blm UTSW 7 80,155,641 (GRCm39) nonsense probably null
R0673:Blm UTSW 7 80,149,499 (GRCm39) critical splice donor site probably null
R0972:Blm UTSW 7 80,163,118 (GRCm39) missense probably benign
R0980:Blm UTSW 7 80,149,706 (GRCm39) splice site probably null
R1120:Blm UTSW 7 80,131,214 (GRCm39) missense probably damaging 1.00
R1301:Blm UTSW 7 80,105,165 (GRCm39) nonsense probably null
R1769:Blm UTSW 7 80,163,118 (GRCm39) missense probably benign
R1866:Blm UTSW 7 80,143,862 (GRCm39) missense probably benign 0.08
R1874:Blm UTSW 7 80,147,166 (GRCm39) missense probably damaging 1.00
R1966:Blm UTSW 7 80,162,934 (GRCm39) missense possibly damaging 0.86
R1991:Blm UTSW 7 80,155,697 (GRCm39) splice site probably null
R2013:Blm UTSW 7 80,152,147 (GRCm39) missense probably damaging 0.99
R2014:Blm UTSW 7 80,152,147 (GRCm39) missense probably damaging 0.99
R2015:Blm UTSW 7 80,152,147 (GRCm39) missense probably damaging 0.99
R2016:Blm UTSW 7 80,155,674 (GRCm39) missense probably benign 0.26
R2103:Blm UTSW 7 80,155,697 (GRCm39) splice site probably null
R2161:Blm UTSW 7 80,131,118 (GRCm39) splice site probably null
R2215:Blm UTSW 7 80,149,595 (GRCm39) missense possibly damaging 0.69
R3689:Blm UTSW 7 80,162,827 (GRCm39) missense possibly damaging 0.56
R4049:Blm UTSW 7 80,152,610 (GRCm39) missense probably benign 0.04
R4155:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R4695:Blm UTSW 7 80,143,976 (GRCm39) missense probably damaging 1.00
R4774:Blm UTSW 7 80,113,596 (GRCm39) missense probably damaging 1.00
R4833:Blm UTSW 7 80,116,574 (GRCm39) missense probably benign
R4835:Blm UTSW 7 80,159,294 (GRCm39) missense probably benign 0.41
R4994:Blm UTSW 7 80,108,573 (GRCm39) missense probably benign 0.00
R5039:Blm UTSW 7 80,155,621 (GRCm39) missense possibly damaging 0.50
R5330:Blm UTSW 7 80,108,684 (GRCm39) missense possibly damaging 0.73
R5375:Blm UTSW 7 80,162,977 (GRCm39) missense probably benign 0.00
R5408:Blm UTSW 7 80,152,370 (GRCm39) missense probably benign 0.01
R5574:Blm UTSW 7 80,149,521 (GRCm39) missense probably damaging 1.00
R5606:Blm UTSW 7 80,110,580 (GRCm39) splice site probably null
R5702:Blm UTSW 7 80,108,675 (GRCm39) missense probably benign 0.13
R5809:Blm UTSW 7 80,114,592 (GRCm39) missense probably damaging 1.00
R6114:Blm UTSW 7 80,163,235 (GRCm39) missense probably damaging 1.00
R6157:Blm UTSW 7 80,162,733 (GRCm39) missense probably benign 0.18
R6163:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R6254:Blm UTSW 7 80,130,090 (GRCm39) missense probably benign 0.04
R6266:Blm UTSW 7 80,149,688 (GRCm39) missense probably benign 0.03
R6364:Blm UTSW 7 80,144,274 (GRCm39) nonsense probably null
R6446:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R6502:Blm UTSW 7 80,131,223 (GRCm39) missense probably damaging 0.98
R6700:Blm UTSW 7 80,113,598 (GRCm39) missense possibly damaging 0.91
R7002:Blm UTSW 7 80,119,501 (GRCm39) missense probably benign 0.00
R7105:Blm UTSW 7 80,149,516 (GRCm39) missense probably benign 0.44
R7320:Blm UTSW 7 80,105,102 (GRCm39) nonsense probably null
R7465:Blm UTSW 7 80,162,863 (GRCm39) missense probably benign 0.02
R7561:Blm UTSW 7 80,152,276 (GRCm39) missense probably damaging 0.99
R8500:Blm UTSW 7 80,105,032 (GRCm39) missense probably damaging 1.00
R8543:Blm UTSW 7 80,143,964 (GRCm39) missense probably damaging 0.98
R8774-TAIL:Blm UTSW 7 80,162,667 (GRCm39) small insertion probably benign
R8774-TAIL:Blm UTSW 7 80,162,655 (GRCm39) small insertion probably benign
R8774-TAIL:Blm UTSW 7 80,162,666 (GRCm39) small insertion probably benign
R8775-TAIL:Blm UTSW 7 80,162,679 (GRCm39) small insertion probably benign
R8860:Blm UTSW 7 80,144,276 (GRCm39) missense probably benign 0.30
R8928:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R9089:Blm UTSW 7 80,162,867 (GRCm39) missense probably damaging 1.00
R9363:Blm UTSW 7 80,108,663 (GRCm39) missense probably damaging 1.00
RF001:Blm UTSW 7 80,162,654 (GRCm39) small insertion probably benign
RF001:Blm UTSW 7 80,162,651 (GRCm39) small insertion probably benign
RF002:Blm UTSW 7 80,162,653 (GRCm39) small insertion probably benign
RF002:Blm UTSW 7 80,162,675 (GRCm39) small insertion probably benign
RF007:Blm UTSW 7 80,162,681 (GRCm39) nonsense probably null
RF016:Blm UTSW 7 80,162,674 (GRCm39) nonsense probably null
RF018:Blm UTSW 7 80,162,674 (GRCm39) nonsense probably null
RF027:Blm UTSW 7 80,162,662 (GRCm39) frame shift probably null
RF028:Blm UTSW 7 80,162,653 (GRCm39) nonsense probably null
RF031:Blm UTSW 7 80,162,671 (GRCm39) small insertion probably benign
RF031:Blm UTSW 7 80,162,654 (GRCm39) small insertion probably benign
RF032:Blm UTSW 7 80,162,678 (GRCm39) small insertion probably benign
RF036:Blm UTSW 7 80,162,662 (GRCm39) nonsense probably null
RF044:Blm UTSW 7 80,162,678 (GRCm39) small insertion probably benign
RF053:Blm UTSW 7 80,162,669 (GRCm39) small insertion probably benign
RF064:Blm UTSW 7 80,162,671 (GRCm39) nonsense probably null
X0061:Blm UTSW 7 80,108,598 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AACTGTCCTGTGTACCGCTG -3'
(R):5'- ATGCGTTTGCTTCACTGGC -3'

Sequencing Primer
(F):5'- CCCAGTGCTCAGCTTTAGATTAG -3'
(R):5'- GCTTCACTGGCTAAAAATCCTG -3'
Posted On 2019-12-04