Incidental Mutation 'RF001:Cherp'
ID 602512
Institutional Source Beutler Lab
Gene Symbol Cherp
Ensembl Gene ENSMUSG00000052488
Gene Name calcium homeostasis endoplasmic reticulum protein
Synonyms DAN16, SCAF6, D8Wsu96e, 5730408I11Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # RF001 (G1)
Quality Score 213.468
Status Not validated
Chromosome 8
Chromosomal Location 73214333-73229070 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) GACCTGGA to G at 73215893 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064853] [ENSMUST00000079510] [ENSMUST00000121902] [ENSMUST00000212991]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000064853
SMART Domains Protein: ENSMUSP00000063244
Gene: ENSMUSG00000052794

DomainStartEndE-ValueType
low complexity region 200 216 N/A INTRINSIC
low complexity region 250 262 N/A INTRINSIC
low complexity region 320 333 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 421 432 N/A INTRINSIC
Pfam:DUF4614 438 608 2e-71 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000079510
SMART Domains Protein: ENSMUSP00000078469
Gene: ENSMUSG00000052488

DomainStartEndE-ValueType
SWAP 13 65 9.76e-24 SMART
low complexity region 78 100 N/A INTRINSIC
low complexity region 107 124 N/A INTRINSIC
RPR 156 286 5.32e-2 SMART
coiled coil region 310 334 N/A INTRINSIC
low complexity region 362 385 N/A INTRINSIC
low complexity region 409 419 N/A INTRINSIC
low complexity region 439 463 N/A INTRINSIC
low complexity region 488 500 N/A INTRINSIC
low complexity region 526 560 N/A INTRINSIC
low complexity region 565 580 N/A INTRINSIC
low complexity region 591 606 N/A INTRINSIC
low complexity region 725 736 N/A INTRINSIC
low complexity region 743 829 N/A INTRINSIC
G_patch 850 900 9.8e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121902
SMART Domains Protein: ENSMUSP00000113279
Gene: ENSMUSG00000052794

DomainStartEndE-ValueType
low complexity region 200 216 N/A INTRINSIC
low complexity region 250 262 N/A INTRINSIC
low complexity region 320 333 N/A INTRINSIC
low complexity region 387 398 N/A INTRINSIC
Pfam:DUF4614 400 575 1.3e-75 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000212991
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik G GTGGCTGCTA 1: 82,891,311 (GRCm39) probably benign Het
Acer1 A G 17: 57,265,909 (GRCm39) V122A probably benign Het
Adam34l T G 8: 44,079,942 (GRCm39) D94A possibly damaging Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,693,974 (GRCm39) probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,479,405 (GRCm39) probably benign Het
Atp13a1 C A 8: 70,252,720 (GRCm39) A680D probably damaging Het
Blm CGCCTCCTCCTC CGCCTCCTCCTCAGCCTCCTCCTC 7: 80,162,651 (GRCm39) probably benign Het
Blm CTCCTCC CTCCTCCTCCTCGTCCTCC 7: 80,162,675 (GRCm39) probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTCCTCCTCCTCCTC 7: 80,162,654 (GRCm39) probably benign Het
Cad GT G 5: 31,217,556 (GRCm39) probably benign Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,129,715 (GRCm39) probably benign Het
Casz1 CACA C 4: 149,036,761 (GRCm39) probably benign Het
Chga AGC AGCTGC 12: 102,527,682 (GRCm39) probably benign Het
Coq7 A G 7: 118,132,405 (GRCm39) S24P probably benign Het
Cul1 T C 6: 47,501,515 (GRCm39) V734A possibly damaging Het
Cyb5r4 GCCCAGGGATGTGACAGACACACT GCCCAGGGATGTGACAGACACACTCCCCAGGGATGTGACAGACACACT 9: 86,922,469 (GRCm39) probably benign Het
Dgkz A T 2: 91,770,286 (GRCm39) F521I possibly damaging Het
Fam171b GCAGCA GCAGCATCAGCA 2: 83,643,230 (GRCm39) probably benign Het
Fat1 T G 8: 45,442,003 (GRCm39) S1102A probably benign Het
Gab3 CTT CTTTTT X: 74,043,624 (GRCm39) probably benign Het
Gm14412 T C 2: 177,008,894 (GRCm39) I52V probably benign Het
Gm5414 T C 15: 101,536,388 (GRCm39) E79G probably benign Het
Gpc5 G A 14: 115,654,590 (GRCm39) S470N probably benign Het
Grin2b A G 6: 136,021,238 (GRCm39) V21A probably benign Het
Hecw1 C A 13: 14,472,009 (GRCm39) C553F probably damaging Het
Hsd3b6 T A 3: 98,713,756 (GRCm39) H181L probably benign Het
Il2 CCAGGTGCTGCTGC CC 3: 37,179,911 (GRCm39) probably benign Het
Inpp5f G A 7: 128,296,807 (GRCm39) G1053R probably damaging Het
Kcnma1 T G 14: 23,361,765 (GRCm39) Y1142S probably damaging Het
Kctd8 T C 5: 69,267,775 (GRCm39) K445R possibly damaging Het
Kmt2b CC CCTCCTTC 7: 30,285,807 (GRCm39) probably benign Het
Kmt2c TG TGTTGCGG 5: 25,520,773 (GRCm39) probably benign Het
Krtap28-10 CACCAC CACCACCGCCACCGCAACCAC 1: 83,020,003 (GRCm39) probably benign Het
Krtap28-10 CACAGCCACAGCCACCACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCACCACAGCCACAGCCAC 1: 83,019,976 (GRCm39) probably benign Het
Krtap28-10 GCCACCACAGC GCCACCACAGCCACATCCACCACAGC 1: 83,020,001 (GRCm39) probably benign Het
Lama1 A G 17: 68,059,897 (GRCm39) D662G Het
Lce1m AC ACTGCTGCTGCCCC 3: 92,925,459 (GRCm39) probably benign Het
Lce1m GCTGCCACC GCTGCCACCACTCCTGCCACC 3: 92,925,576 (GRCm39) probably benign Het
Lmo4 A C 3: 143,907,623 (GRCm39) S63A possibly damaging Het
Lrrk2 T C 15: 91,620,836 (GRCm39) I952T probably benign Het
Lyst T C 13: 13,810,426 (GRCm39) F699L probably benign Het
Matn3 T A 12: 9,008,797 (GRCm39) D303E probably benign Het
Me1 A G 9: 86,464,876 (GRCm39) Y545H probably damaging Het
Mettl3 A T 14: 52,537,756 (GRCm39) V68E probably benign Het
Mptx2 T C 1: 173,102,536 (GRCm39) N51S probably benign Het
Mylk A G 16: 34,699,741 (GRCm39) D368G probably benign Het
Myom2 T C 8: 15,131,418 (GRCm39) V372A possibly damaging Het
Neb T C 2: 52,085,433 (GRCm39) D5569G probably damaging Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGCGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,030 (GRCm39) probably benign Het
P4ha2 CCAGGTG C 11: 54,001,061 (GRCm39) probably benign Het
Pop1 G A 15: 34,502,583 (GRCm39) G90D probably damaging Het
Rbm12 CC CCGGGTATTGTGGGACCAGTTATTGCGGGAGC 2: 155,937,995 (GRCm39) probably benign Het
Sertad4 T C 1: 192,529,486 (GRCm39) Y110C probably damaging Het
Setd1a GGTAGTGGT GGTAGTGGTAGTAGTGGT 7: 127,384,486 (GRCm39) probably benign Het
Smarca2 AGC AGCCCCGGC 19: 26,608,421 (GRCm39) probably benign Het
Smarca2 ACA ACAACAGCA 19: 26,608,386 (GRCm39) probably benign Het
Supt20 AGCA AGCACCCGCA 3: 54,635,083 (GRCm39) probably benign Het
Tcof1 AGC AGCCGC 18: 60,968,811 (GRCm39) probably benign Het
Tecpr1 A G 5: 144,154,204 (GRCm39) F83S probably damaging Het
Triobp GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA 15: 78,851,227 (GRCm39) probably benign Het
Vmn1r48 A T 6: 90,013,186 (GRCm39) M213K probably benign Het
Zc3h4 CCC CCCTGACATGCATCC 7: 16,163,612 (GRCm39) probably benign Het
Zscan29 T C 2: 120,994,477 (GRCm39) N503D possibly damaging Het
Other mutations in Cherp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Cherp APN 8 73,222,090 (GRCm39) missense probably damaging 0.97
IGL00955:Cherp APN 8 73,224,038 (GRCm39) missense probably damaging 0.99
R0452:Cherp UTSW 8 73,215,366 (GRCm39) unclassified probably benign
R0479:Cherp UTSW 8 73,216,991 (GRCm39) missense possibly damaging 0.66
R0594:Cherp UTSW 8 73,216,246 (GRCm39) critical splice donor site probably null
R1734:Cherp UTSW 8 73,223,932 (GRCm39) critical splice donor site probably null
R1781:Cherp UTSW 8 73,221,615 (GRCm39) missense probably damaging 1.00
R1793:Cherp UTSW 8 73,216,994 (GRCm39) missense probably benign 0.12
R2012:Cherp UTSW 8 73,228,613 (GRCm39) missense probably damaging 0.98
R2845:Cherp UTSW 8 73,220,247 (GRCm39) missense probably damaging 0.99
R3612:Cherp UTSW 8 73,215,840 (GRCm39) unclassified probably benign
R3693:Cherp UTSW 8 73,221,755 (GRCm39) small deletion probably benign
R3899:Cherp UTSW 8 73,223,780 (GRCm39) missense possibly damaging 0.63
R3900:Cherp UTSW 8 73,223,780 (GRCm39) missense possibly damaging 0.63
R3970:Cherp UTSW 8 73,223,795 (GRCm39) missense possibly damaging 0.60
R4915:Cherp UTSW 8 73,222,241 (GRCm39) missense probably damaging 1.00
R5512:Cherp UTSW 8 73,217,110 (GRCm39) missense possibly damaging 0.66
R5556:Cherp UTSW 8 73,221,824 (GRCm39) missense probably damaging 0.99
R5739:Cherp UTSW 8 73,221,659 (GRCm39) small deletion probably benign
R5768:Cherp UTSW 8 73,216,957 (GRCm39) missense probably damaging 0.98
R5824:Cherp UTSW 8 73,216,102 (GRCm39) unclassified probably benign
R5963:Cherp UTSW 8 73,215,379 (GRCm39) unclassified probably benign
R6255:Cherp UTSW 8 73,224,725 (GRCm39) missense probably damaging 0.99
R7145:Cherp UTSW 8 73,222,230 (GRCm39) missense
R7538:Cherp UTSW 8 73,216,263 (GRCm39) missense
R7578:Cherp UTSW 8 73,218,102 (GRCm39) missense
R8329:Cherp UTSW 8 73,215,852 (GRCm39) missense
R9717:Cherp UTSW 8 73,216,920 (GRCm39) critical splice donor site probably null
RF007:Cherp UTSW 8 73,215,903 (GRCm39) small deletion probably benign
RF036:Cherp UTSW 8 73,215,891 (GRCm39) frame shift probably null
RF036:Cherp UTSW 8 73,215,888 (GRCm39) frame shift probably null
RF059:Cherp UTSW 8 73,215,899 (GRCm39) frame shift probably null
T0722:Cherp UTSW 8 73,215,878 (GRCm39) small deletion probably benign
T0975:Cherp UTSW 8 73,215,878 (GRCm39) small deletion probably benign
Z1176:Cherp UTSW 8 73,224,797 (GRCm39) missense
Z1177:Cherp UTSW 8 73,228,979 (GRCm39) start gained probably benign
Z1177:Cherp UTSW 8 73,216,760 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TGTCAATCCCTACAACAGGC -3'
(R):5'- TGGTTGCTGTAACTGCCGTC -3'

Sequencing Primer
(F):5'- GGCCCCTGACACCAAGAG -3'
(R):5'- ACGGTGGCATTCCCTTG -3'
Posted On 2019-12-04