Incidental Mutation 'RF001:Me1'
ID602513
Institutional Source Beutler Lab
Gene Symbol Me1
Ensembl Gene ENSMUSG00000032418
Gene Namemalic enzyme 1, NADP(+)-dependent, cytosolic
SynonymsMod-1, Mdh-1, Mod1, D9Ertd267e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location86581371-86695953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86582823 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 545 (Y545H)
Ref Sequence ENSEMBL: ENSMUSP00000034989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034989] [ENSMUST00000185374]
Predicted Effect probably damaging
Transcript: ENSMUST00000034989
AA Change: Y545H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034989
Gene: ENSMUSG00000032418
AA Change: Y545H

DomainStartEndE-ValueType
malic 79 260 7.34e-106 SMART
Malic_M 270 522 1.09e-111 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185374
AA Change: Y525H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140887
Gene: ENSMUSG00000032418
AA Change: Y525H

DomainStartEndE-ValueType
malic 59 240 7.34e-106 SMART
Malic_M 250 502 1.09e-111 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic, NADP-dependent enzyme that generates NADPH for fatty acid biosynthesis. The activity of this enzyme, the reversible oxidative decarboxylation of malate, links the glycolytic and citric acid cycles. The regulation of expression for this gene is complex. Increased expression can result from elevated levels of thyroid hormones or by higher proportions of carbohydrates in the diet. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit decreased body weight on a medium fat diet, altered cytoplasmic malic enzyme activity, and a male-specific reduction in food intake on a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik G GTGGCTGCTA 1: 82,913,590 probably benign Het
Acer1 A G 17: 56,958,909 V122A probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,921 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Atp13a1 C A 8: 69,800,070 A680D probably damaging Het
Blm CGCCTCCTCCTC CGCCTCCTCCTCAGCCTCCTCCTC 7: 80,512,903 probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTCCTCCTCCTCCTC 7: 80,512,906 probably benign Het
Blm CTCCTCC CTCCTCCTCCTCGTCCTCC 7: 80,512,927 probably benign Het
Cad GT G 5: 31,060,212 probably benign Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,141,276 probably benign Het
Casz1 CACA C 4: 148,952,304 probably benign Het
Cherp GACCTGGA G 8: 72,462,049 probably null Het
Chga AGC AGCTGC 12: 102,561,423 probably benign Het
Coq7 A G 7: 118,533,182 S24P probably benign Het
Cul1 T C 6: 47,524,581 V734A possibly damaging Het
Cyb5r4 GCCCAGGGATGTGACAGACACACT GCCCAGGGATGTGACAGACACACTCCCCAGGGATGTGACAGACACACT 9: 87,040,416 probably benign Het
Dgkz A T 2: 91,939,941 F521I possibly damaging Het
Fam171b GCAGCA GCAGCATCAGCA 2: 83,812,886 probably benign Het
Fat1 T G 8: 44,988,966 S1102A probably benign Het
Gab3 CTT CTTTTT X: 75,000,018 probably benign Het
Gm14412 T C 2: 177,317,101 I52V probably benign Het
Gm5346 T G 8: 43,626,905 D94A possibly damaging Het
Gm5414 T C 15: 101,627,953 E79G probably benign Het
Gpc5 G A 14: 115,417,178 S470N probably benign Het
Grin2b A G 6: 136,044,240 V21A probably benign Het
Hecw1 C A 13: 14,297,424 C553F probably damaging Het
Hsd3b6 T A 3: 98,806,440 H181L probably benign Het
Il2 CCAGGTGCTGCTGC CC 3: 37,125,762 probably benign Het
Inpp5f G A 7: 128,695,083 G1053R probably damaging Het
Kcnma1 T G 14: 23,311,697 Y1142S probably damaging Het
Kctd8 T C 5: 69,110,432 K445R possibly damaging Het
Kmt2b CC CCTCCTTC 7: 30,586,382 probably benign Het
Kmt2c TG TGTTGCGG 5: 25,315,775 probably benign Het
Krtap28-10 CACAGCCACAGCCACCACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCACCACAGCCACAGCCAC 1: 83,042,255 probably benign Het
Krtap28-10 GCCACCACAGC GCCACCACAGCCACATCCACCACAGC 1: 83,042,280 probably benign Het
Krtap28-10 CACCAC CACCACCGCCACCGCAACCAC 1: 83,042,282 probably benign Het
Lama1 A G 17: 67,752,902 D662G Het
Lce1m AC ACTGCTGCTGCCCC 3: 93,018,152 probably benign Het
Lce1m GCTGCCACC GCTGCCACCACTCCTGCCACC 3: 93,018,269 probably benign Het
Lmo4 A C 3: 144,201,862 S63A possibly damaging Het
Lrrk2 T C 15: 91,736,633 I952T probably benign Het
Lyst T C 13: 13,635,841 F699L probably benign Het
Matn3 T A 12: 8,958,797 D303E probably benign Het
Mettl3 A T 14: 52,300,299 V68E probably benign Het
Mptx2 T C 1: 173,274,969 N51S probably benign Het
Mylk A G 16: 34,879,371 D368G probably benign Het
Myom2 T C 8: 15,081,418 V372A possibly damaging Het
Neb T C 2: 52,195,421 D5569G probably damaging Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGCGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,030 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Rbm12 CC CCGGGTATTGTGGGACCAGTTATTGCGGGAGC 2: 156,096,075 probably benign Het
Sertad4 T C 1: 192,847,178 Y110C probably damaging Het
Setd1a GGTAGTGGT GGTAGTGGTAGTAGTGGT 7: 127,785,314 probably benign Het
Smarca2 ACA ACAACAGCA 19: 26,630,986 probably benign Het
Smarca2 AGC AGCCCCGGC 19: 26,631,021 probably benign Het
Supt20 AGCA AGCACCCGCA 3: 54,727,662 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tecpr1 A G 5: 144,217,386 F83S probably damaging Het
Triobp GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA 15: 78,967,027 probably benign Het
Vmn1r48 A T 6: 90,036,204 M213K probably benign Het
Zc3h4 CCC CCCTGACATGCATCC 7: 16,429,687 probably benign Het
Zscan29 T C 2: 121,163,996 N503D possibly damaging Het
Other mutations in Me1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Me1 APN 9 86598748 missense probably damaging 1.00
IGL01326:Me1 APN 9 86598718 critical splice donor site probably null
IGL02231:Me1 APN 9 86611855 missense possibly damaging 0.92
IGL02343:Me1 APN 9 86654641 critical splice donor site probably null
IGL02444:Me1 APN 9 86582914 splice site probably benign
IGL02655:Me1 APN 9 86654727 splice site probably benign
IGL03282:Me1 APN 9 86613596 missense probably damaging 0.99
R0116:Me1 UTSW 9 86654667 missense probably benign 0.01
R0270:Me1 UTSW 9 86596204 splice site probably benign
R0361:Me1 UTSW 9 86651002 missense probably damaging 1.00
R1535:Me1 UTSW 9 86587043 missense probably damaging 0.96
R1601:Me1 UTSW 9 86678012 missense probably damaging 1.00
R1807:Me1 UTSW 9 86650879 missense probably damaging 0.98
R2085:Me1 UTSW 9 86613554 missense probably damaging 1.00
R2571:Me1 UTSW 9 86654698 missense probably damaging 1.00
R3012:Me1 UTSW 9 86611912 missense probably benign 0.00
R4649:Me1 UTSW 9 86679852 missense probably benign 0.00
R5540:Me1 UTSW 9 86679873 missense possibly damaging 0.60
R6129:Me1 UTSW 9 86650956 missense probably damaging 1.00
R6727:Me1 UTSW 9 86582798 missense possibly damaging 0.92
R7718:Me1 UTSW 9 86679900 missense probably damaging 1.00
R8329:Me1 UTSW 9 86619737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTCTGGTGTGAAATTTATCC -3'
(R):5'- TGCTACATCTGATTCATAGCTGC -3'

Sequencing Primer
(F):5'- AATCACCTTATTCTAAGCACACTATG -3'
(R):5'- ACATCTGATTCATAGCTGCATTTTC -3'
Posted On2019-12-04