Incidental Mutation 'RF001:P4ha2'
ID 602517
Institutional Source Beutler Lab
Gene Symbol P4ha2
Ensembl Gene ENSMUSG00000018906
Gene Name procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha II polypeptide
Synonyms P4hl
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.366) question?
Stock # RF001 (G1)
Quality Score 162.468
Status Not validated
Chromosome 11
Chromosomal Location 53991750-54022494 bp(+) (GRCm39)
Type of Mutation small deletion (2 aa in frame mutation)
DNA Base Change (assembly) CCAGGTG to C at 54001061 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019050] [ENSMUST00000093107] [ENSMUST00000125132] [ENSMUST00000126840] [ENSMUST00000129499] [ENSMUST00000135653] [ENSMUST00000138477] [ENSMUST00000141258] [ENSMUST00000151218] [ENSMUST00000174616]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000019050
SMART Domains Protein: ENSMUSP00000019050
Gene: ENSMUSG00000018906

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 28 159 2.6e-40 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
Blast:P4Hc 232 303 4e-13 BLAST
P4Hc 338 521 1.61e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093107
SMART Domains Protein: ENSMUSP00000091749
Gene: ENSMUSG00000018906

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 160 6.3e-44 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
P4Hc 338 519 7.67e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125132
Predicted Effect probably benign
Transcript: ENSMUST00000126840
SMART Domains Protein: ENSMUSP00000121955
Gene: ENSMUSG00000018906

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 108 3.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129499
SMART Domains Protein: ENSMUSP00000115245
Gene: ENSMUSG00000018906

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135653
SMART Domains Protein: ENSMUSP00000119861
Gene: ENSMUSG00000018906

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 112 1.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138477
SMART Domains Protein: ENSMUSP00000121119
Gene: ENSMUSG00000018906

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 158 3.1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141258
Predicted Effect probably benign
Transcript: ENSMUST00000151218
SMART Domains Protein: ENSMUSP00000118384
Gene: ENSMUSG00000018906

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 128 6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174616
SMART Domains Protein: ENSMUSP00000133275
Gene: ENSMUSG00000018906

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 160 6.3e-44 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
P4Hc 338 519 7.67e-65 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik G GTGGCTGCTA 1: 82,891,311 (GRCm39) probably benign Het
Acer1 A G 17: 57,265,909 (GRCm39) V122A probably benign Het
Adam34l T G 8: 44,079,942 (GRCm39) D94A possibly damaging Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,693,974 (GRCm39) probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,479,405 (GRCm39) probably benign Het
Atp13a1 C A 8: 70,252,720 (GRCm39) A680D probably damaging Het
Blm CGCCTCCTCCTC CGCCTCCTCCTCAGCCTCCTCCTC 7: 80,162,651 (GRCm39) probably benign Het
Blm CTCCTCC CTCCTCCTCCTCGTCCTCC 7: 80,162,675 (GRCm39) probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTCCTCCTCCTCCTC 7: 80,162,654 (GRCm39) probably benign Het
Cad GT G 5: 31,217,556 (GRCm39) probably benign Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,129,715 (GRCm39) probably benign Het
Casz1 CACA C 4: 149,036,761 (GRCm39) probably benign Het
Cherp GACCTGGA G 8: 73,215,893 (GRCm39) probably null Het
Chga AGC AGCTGC 12: 102,527,682 (GRCm39) probably benign Het
Coq7 A G 7: 118,132,405 (GRCm39) S24P probably benign Het
Cul1 T C 6: 47,501,515 (GRCm39) V734A possibly damaging Het
Cyb5r4 GCCCAGGGATGTGACAGACACACT GCCCAGGGATGTGACAGACACACTCCCCAGGGATGTGACAGACACACT 9: 86,922,469 (GRCm39) probably benign Het
Dgkz A T 2: 91,770,286 (GRCm39) F521I possibly damaging Het
Fam171b GCAGCA GCAGCATCAGCA 2: 83,643,230 (GRCm39) probably benign Het
Fat1 T G 8: 45,442,003 (GRCm39) S1102A probably benign Het
Gab3 CTT CTTTTT X: 74,043,624 (GRCm39) probably benign Het
Gm14412 T C 2: 177,008,894 (GRCm39) I52V probably benign Het
Gm5414 T C 15: 101,536,388 (GRCm39) E79G probably benign Het
Gpc5 G A 14: 115,654,590 (GRCm39) S470N probably benign Het
Grin2b A G 6: 136,021,238 (GRCm39) V21A probably benign Het
Hecw1 C A 13: 14,472,009 (GRCm39) C553F probably damaging Het
Hsd3b6 T A 3: 98,713,756 (GRCm39) H181L probably benign Het
Il2 CCAGGTGCTGCTGC CC 3: 37,179,911 (GRCm39) probably benign Het
Inpp5f G A 7: 128,296,807 (GRCm39) G1053R probably damaging Het
Kcnma1 T G 14: 23,361,765 (GRCm39) Y1142S probably damaging Het
Kctd8 T C 5: 69,267,775 (GRCm39) K445R possibly damaging Het
Kmt2b CC CCTCCTTC 7: 30,285,807 (GRCm39) probably benign Het
Kmt2c TG TGTTGCGG 5: 25,520,773 (GRCm39) probably benign Het
Krtap28-10 CACCAC CACCACCGCCACCGCAACCAC 1: 83,020,003 (GRCm39) probably benign Het
Krtap28-10 CACAGCCACAGCCACCACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCACCACAGCCACAGCCAC 1: 83,019,976 (GRCm39) probably benign Het
Krtap28-10 GCCACCACAGC GCCACCACAGCCACATCCACCACAGC 1: 83,020,001 (GRCm39) probably benign Het
Lama1 A G 17: 68,059,897 (GRCm39) D662G Het
Lce1m AC ACTGCTGCTGCCCC 3: 92,925,459 (GRCm39) probably benign Het
Lce1m GCTGCCACC GCTGCCACCACTCCTGCCACC 3: 92,925,576 (GRCm39) probably benign Het
Lmo4 A C 3: 143,907,623 (GRCm39) S63A possibly damaging Het
Lrrk2 T C 15: 91,620,836 (GRCm39) I952T probably benign Het
Lyst T C 13: 13,810,426 (GRCm39) F699L probably benign Het
Matn3 T A 12: 9,008,797 (GRCm39) D303E probably benign Het
Me1 A G 9: 86,464,876 (GRCm39) Y545H probably damaging Het
Mettl3 A T 14: 52,537,756 (GRCm39) V68E probably benign Het
Mptx2 T C 1: 173,102,536 (GRCm39) N51S probably benign Het
Mylk A G 16: 34,699,741 (GRCm39) D368G probably benign Het
Myom2 T C 8: 15,131,418 (GRCm39) V372A possibly damaging Het
Neb T C 2: 52,085,433 (GRCm39) D5569G probably damaging Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGCGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,030 (GRCm39) probably benign Het
Pop1 G A 15: 34,502,583 (GRCm39) G90D probably damaging Het
Rbm12 CC CCGGGTATTGTGGGACCAGTTATTGCGGGAGC 2: 155,937,995 (GRCm39) probably benign Het
Sertad4 T C 1: 192,529,486 (GRCm39) Y110C probably damaging Het
Setd1a GGTAGTGGT GGTAGTGGTAGTAGTGGT 7: 127,384,486 (GRCm39) probably benign Het
Smarca2 AGC AGCCCCGGC 19: 26,608,421 (GRCm39) probably benign Het
Smarca2 ACA ACAACAGCA 19: 26,608,386 (GRCm39) probably benign Het
Supt20 AGCA AGCACCCGCA 3: 54,635,083 (GRCm39) probably benign Het
Tcof1 AGC AGCCGC 18: 60,968,811 (GRCm39) probably benign Het
Tecpr1 A G 5: 144,154,204 (GRCm39) F83S probably damaging Het
Triobp GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA 15: 78,851,227 (GRCm39) probably benign Het
Vmn1r48 A T 6: 90,013,186 (GRCm39) M213K probably benign Het
Zc3h4 CCC CCCTGACATGCATCC 7: 16,163,612 (GRCm39) probably benign Het
Zscan29 T C 2: 120,994,477 (GRCm39) N503D possibly damaging Het
Other mutations in P4ha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:P4ha2 APN 11 54,010,131 (GRCm39) missense probably damaging 1.00
IGL01324:P4ha2 APN 11 54,010,984 (GRCm39) missense probably damaging 0.99
IGL01953:P4ha2 APN 11 54,004,996 (GRCm39) missense probably benign 0.07
IGL02053:P4ha2 APN 11 54,008,413 (GRCm39) missense probably benign
FR4342:P4ha2 UTSW 11 54,001,077 (GRCm39) small deletion probably benign
R0471:P4ha2 UTSW 11 54,008,434 (GRCm39) missense possibly damaging 0.82
R0938:P4ha2 UTSW 11 54,010,148 (GRCm39) missense possibly damaging 0.67
R1467:P4ha2 UTSW 11 53,997,236 (GRCm39) intron probably benign
R1517:P4ha2 UTSW 11 54,008,471 (GRCm39) missense probably benign
R1556:P4ha2 UTSW 11 54,015,836 (GRCm39) missense probably damaging 0.98
R3498:P4ha2 UTSW 11 54,010,079 (GRCm39) missense probably benign 0.28
R3916:P4ha2 UTSW 11 54,017,074 (GRCm39) missense probably benign 0.07
R4853:P4ha2 UTSW 11 54,010,996 (GRCm39) missense probably benign 0.01
R4932:P4ha2 UTSW 11 54,015,846 (GRCm39) missense probably benign 0.05
R5020:P4ha2 UTSW 11 54,022,016 (GRCm39) missense probably damaging 1.00
R5892:P4ha2 UTSW 11 54,011,014 (GRCm39) missense probably damaging 1.00
R5975:P4ha2 UTSW 11 54,017,238 (GRCm39) critical splice donor site probably null
R6632:P4ha2 UTSW 11 54,008,474 (GRCm39) missense probably benign 0.07
R7023:P4ha2 UTSW 11 54,022,072 (GRCm39) missense probably benign 0.01
R7068:P4ha2 UTSW 11 54,001,820 (GRCm39) missense probably benign 0.03
R8963:P4ha2 UTSW 11 54,004,995 (GRCm39) missense probably benign 0.01
R9215:P4ha2 UTSW 11 54,017,226 (GRCm39) missense probably benign 0.27
R9224:P4ha2 UTSW 11 54,009,963 (GRCm39) missense possibly damaging 0.92
R9336:P4ha2 UTSW 11 54,002,390 (GRCm39) missense possibly damaging 0.67
R9582:P4ha2 UTSW 11 54,022,065 (GRCm39) nonsense probably null
RF018:P4ha2 UTSW 11 54,001,072 (GRCm39) frame shift probably null
RF035:P4ha2 UTSW 11 54,001,061 (GRCm39) small deletion probably benign
RF043:P4ha2 UTSW 11 54,001,076 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATCCCCTGGGTGATCCTGAATG -3'
(R):5'- CCCTGGACTGGTCAAAATCAC -3'

Sequencing Primer
(F):5'- TCCTGAATGCTTTATTTAGTGACATC -3'
(R):5'- GGACTGGTCAAAATCACTGACTAAAC -3'
Posted On 2019-12-04