Incidental Mutation 'RF001:Mettl3'
ID 602523
Institutional Source Beutler Lab
Gene Symbol Mettl3
Ensembl Gene ENSMUSG00000022160
Gene Name methyltransferase 3, N6-adenosine-methyltransferase complex catalytic subunit
Synonyms M6A, 2310024F18Rik, Spo8
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF001 (G1)
Quality Score 184.009
Status Not validated
Chromosome 14
Chromosomal Location 52532298-52542585 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 52537756 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 68 (V68E)
Ref Sequence ENSEMBL: ENSMUSP00000022767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022766] [ENSMUST00000022767] [ENSMUST00000122962] [ENSMUST00000145875] [ENSMUST00000147768] [ENSMUST00000173138] [ENSMUST00000173896] [ENSMUST00000174351] [ENSMUST00000174853]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000022766
SMART Domains Protein: ENSMUSP00000022766
Gene: ENSMUSG00000016831

DomainStartEndE-ValueType
low complexity region 146 160 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
HMG 222 292 1.17e-18 SMART
low complexity region 307 339 N/A INTRINSIC
low complexity region 435 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000022767
AA Change: V68E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022767
Gene: ENSMUSG00000022160
AA Change: V68E

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 191 213 N/A INTRINSIC
Pfam:MT-A70 389 550 9.9e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122962
Predicted Effect probably benign
Transcript: ENSMUST00000145875
Predicted Effect probably benign
Transcript: ENSMUST00000147768
AA Change: V68E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134577
Gene: ENSMUSG00000022160
AA Change: V68E

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 191 213 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173138
AA Change: V68E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134018
Gene: ENSMUSG00000022160
AA Change: V68E

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173656
SMART Domains Protein: ENSMUSP00000133759
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
Pfam:MT-A70 1 60 8.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173896
AA Change: V68E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133506
Gene: ENSMUSG00000022160
AA Change: V68E

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174351
AA Change: V17E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134732
Gene: ENSMUSG00000022160
AA Change: V17E

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 140 162 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174360
SMART Domains Protein: ENSMUSP00000134578
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
Pfam:MT-A70 1 34 4.3e-10 PFAM
Pfam:MT-A70 30 74 1.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174853
SMART Domains Protein: ENSMUSP00000133864
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
low complexity region 120 142 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 70 kDa subunit of MT-A which is part of N6-adenosine-methyltransferase. This enzyme is involved in the posttranscriptional methylation of internal adenosine residues in eukaryotic mRNAs, forming N6-methyladenosine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E3.5 and E8.5 with a deficiency in adopting the epiblast egg cylinder. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik G GTGGCTGCTA 1: 82,891,311 (GRCm39) probably benign Het
Acer1 A G 17: 57,265,909 (GRCm39) V122A probably benign Het
Adam34l T G 8: 44,079,942 (GRCm39) D94A possibly damaging Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,693,974 (GRCm39) probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,479,405 (GRCm39) probably benign Het
Atp13a1 C A 8: 70,252,720 (GRCm39) A680D probably damaging Het
Blm CGCCTCCTCCTC CGCCTCCTCCTCAGCCTCCTCCTC 7: 80,162,651 (GRCm39) probably benign Het
Blm CTCCTCC CTCCTCCTCCTCGTCCTCC 7: 80,162,675 (GRCm39) probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTCCTCCTCCTCCTC 7: 80,162,654 (GRCm39) probably benign Het
Cad GT G 5: 31,217,556 (GRCm39) probably benign Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,129,715 (GRCm39) probably benign Het
Casz1 CACA C 4: 149,036,761 (GRCm39) probably benign Het
Cherp GACCTGGA G 8: 73,215,893 (GRCm39) probably null Het
Chga AGC AGCTGC 12: 102,527,682 (GRCm39) probably benign Het
Coq7 A G 7: 118,132,405 (GRCm39) S24P probably benign Het
Cul1 T C 6: 47,501,515 (GRCm39) V734A possibly damaging Het
Cyb5r4 GCCCAGGGATGTGACAGACACACT GCCCAGGGATGTGACAGACACACTCCCCAGGGATGTGACAGACACACT 9: 86,922,469 (GRCm39) probably benign Het
Dgkz A T 2: 91,770,286 (GRCm39) F521I possibly damaging Het
Fam171b GCAGCA GCAGCATCAGCA 2: 83,643,230 (GRCm39) probably benign Het
Fat1 T G 8: 45,442,003 (GRCm39) S1102A probably benign Het
Gab3 CTT CTTTTT X: 74,043,624 (GRCm39) probably benign Het
Gm14412 T C 2: 177,008,894 (GRCm39) I52V probably benign Het
Gm5414 T C 15: 101,536,388 (GRCm39) E79G probably benign Het
Gpc5 G A 14: 115,654,590 (GRCm39) S470N probably benign Het
Grin2b A G 6: 136,021,238 (GRCm39) V21A probably benign Het
Hecw1 C A 13: 14,472,009 (GRCm39) C553F probably damaging Het
Hsd3b6 T A 3: 98,713,756 (GRCm39) H181L probably benign Het
Il2 CCAGGTGCTGCTGC CC 3: 37,179,911 (GRCm39) probably benign Het
Inpp5f G A 7: 128,296,807 (GRCm39) G1053R probably damaging Het
Kcnma1 T G 14: 23,361,765 (GRCm39) Y1142S probably damaging Het
Kctd8 T C 5: 69,267,775 (GRCm39) K445R possibly damaging Het
Kmt2b CC CCTCCTTC 7: 30,285,807 (GRCm39) probably benign Het
Kmt2c TG TGTTGCGG 5: 25,520,773 (GRCm39) probably benign Het
Krtap28-10 CACCAC CACCACCGCCACCGCAACCAC 1: 83,020,003 (GRCm39) probably benign Het
Krtap28-10 CACAGCCACAGCCACCACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCACCACAGCCACAGCCAC 1: 83,019,976 (GRCm39) probably benign Het
Krtap28-10 GCCACCACAGC GCCACCACAGCCACATCCACCACAGC 1: 83,020,001 (GRCm39) probably benign Het
Lama1 A G 17: 68,059,897 (GRCm39) D662G Het
Lce1m AC ACTGCTGCTGCCCC 3: 92,925,459 (GRCm39) probably benign Het
Lce1m GCTGCCACC GCTGCCACCACTCCTGCCACC 3: 92,925,576 (GRCm39) probably benign Het
Lmo4 A C 3: 143,907,623 (GRCm39) S63A possibly damaging Het
Lrrk2 T C 15: 91,620,836 (GRCm39) I952T probably benign Het
Lyst T C 13: 13,810,426 (GRCm39) F699L probably benign Het
Matn3 T A 12: 9,008,797 (GRCm39) D303E probably benign Het
Me1 A G 9: 86,464,876 (GRCm39) Y545H probably damaging Het
Mptx2 T C 1: 173,102,536 (GRCm39) N51S probably benign Het
Mylk A G 16: 34,699,741 (GRCm39) D368G probably benign Het
Myom2 T C 8: 15,131,418 (GRCm39) V372A possibly damaging Het
Neb T C 2: 52,085,433 (GRCm39) D5569G probably damaging Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGCGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,030 (GRCm39) probably benign Het
P4ha2 CCAGGTG C 11: 54,001,061 (GRCm39) probably benign Het
Pop1 G A 15: 34,502,583 (GRCm39) G90D probably damaging Het
Rbm12 CC CCGGGTATTGTGGGACCAGTTATTGCGGGAGC 2: 155,937,995 (GRCm39) probably benign Het
Sertad4 T C 1: 192,529,486 (GRCm39) Y110C probably damaging Het
Setd1a GGTAGTGGT GGTAGTGGTAGTAGTGGT 7: 127,384,486 (GRCm39) probably benign Het
Smarca2 AGC AGCCCCGGC 19: 26,608,421 (GRCm39) probably benign Het
Smarca2 ACA ACAACAGCA 19: 26,608,386 (GRCm39) probably benign Het
Supt20 AGCA AGCACCCGCA 3: 54,635,083 (GRCm39) probably benign Het
Tcof1 AGC AGCCGC 18: 60,968,811 (GRCm39) probably benign Het
Tecpr1 A G 5: 144,154,204 (GRCm39) F83S probably damaging Het
Triobp GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA 15: 78,851,227 (GRCm39) probably benign Het
Vmn1r48 A T 6: 90,013,186 (GRCm39) M213K probably benign Het
Zc3h4 CCC CCCTGACATGCATCC 7: 16,163,612 (GRCm39) probably benign Het
Zscan29 T C 2: 120,994,477 (GRCm39) N503D possibly damaging Het
Other mutations in Mettl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Mettl3 APN 14 52,534,424 (GRCm39) unclassified probably benign
IGL00508:Mettl3 APN 14 52,532,436 (GRCm39) unclassified probably benign
R0417:Mettl3 UTSW 14 52,534,155 (GRCm39) missense probably damaging 1.00
R1533:Mettl3 UTSW 14 52,534,385 (GRCm39) missense probably benign 0.01
R2113:Mettl3 UTSW 14 52,532,441 (GRCm39) makesense probably null
R3785:Mettl3 UTSW 14 52,537,363 (GRCm39) missense probably benign 0.15
R3786:Mettl3 UTSW 14 52,537,363 (GRCm39) missense probably benign 0.15
R4651:Mettl3 UTSW 14 52,532,549 (GRCm39) missense probably damaging 1.00
R4652:Mettl3 UTSW 14 52,532,549 (GRCm39) missense probably damaging 1.00
R4938:Mettl3 UTSW 14 52,537,184 (GRCm39) missense probably damaging 1.00
R5462:Mettl3 UTSW 14 52,537,336 (GRCm39) missense probably damaging 0.96
R6046:Mettl3 UTSW 14 52,536,243 (GRCm39) missense possibly damaging 0.91
R6151:Mettl3 UTSW 14 52,532,477 (GRCm39) missense probably damaging 1.00
R6169:Mettl3 UTSW 14 52,536,214 (GRCm39) missense possibly damaging 0.88
R6225:Mettl3 UTSW 14 52,534,215 (GRCm39) splice site probably null
R6282:Mettl3 UTSW 14 52,535,428 (GRCm39) missense probably benign 0.01
R8038:Mettl3 UTSW 14 52,537,421 (GRCm39) missense possibly damaging 0.80
R8110:Mettl3 UTSW 14 52,537,709 (GRCm39) missense probably benign 0.02
R9332:Mettl3 UTSW 14 52,534,125 (GRCm39) missense probably damaging 1.00
R9757:Mettl3 UTSW 14 52,537,361 (GRCm39) missense probably benign 0.00
X0025:Mettl3 UTSW 14 52,535,545 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- CATCTTGAGTGGCAGGTGCATC -3'
(R):5'- CTAGCGATGCTGGACAGTTG -3'

Sequencing Primer
(F):5'- GCAGGTGCATCTGGCTAAAG -3'
(R):5'- ATGCTGGACAGTTGAACCC -3'
Posted On 2019-12-04