Incidental Mutation 'RF001:Gpc5'
ID 602524
Institutional Source Beutler Lab
Gene Symbol Gpc5
Ensembl Gene ENSMUSG00000022112
Gene Name glypican 5
Synonyms A230034F01Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 115329647-116762591 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 115654590 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 470 (S470N)
Ref Sequence ENSEMBL: ENSMUSP00000135857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022707] [ENSMUST00000175665] [ENSMUST00000176912]
AlphaFold Q8CAL5
Predicted Effect probably benign
Transcript: ENSMUST00000022707
SMART Domains Protein: ENSMUSP00000022707
Gene: ENSMUSG00000022112

Pfam:Glypican 9 572 1.8e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175665
AA Change: S470N

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135857
Gene: ENSMUSG00000022112
AA Change: S470N

Pfam:Glypican 82 480 1.3e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176912
SMART Domains Protein: ENSMUSP00000135085
Gene: ENSMUSG00000022112

Pfam:Glypican 85 642 1.6e-174 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik G GTGGCTGCTA 1: 82,891,311 (GRCm39) probably benign Het
Acer1 A G 17: 57,265,909 (GRCm39) V122A probably benign Het
Adam34l T G 8: 44,079,942 (GRCm39) D94A possibly damaging Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,693,974 (GRCm39) probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,479,405 (GRCm39) probably benign Het
Atp13a1 C A 8: 70,252,720 (GRCm39) A680D probably damaging Het
Blm CGCCTCCTCCTC CGCCTCCTCCTCAGCCTCCTCCTC 7: 80,162,651 (GRCm39) probably benign Het
Blm CTCCTCC CTCCTCCTCCTCGTCCTCC 7: 80,162,675 (GRCm39) probably benign Het
Cad GT G 5: 31,217,556 (GRCm39) probably benign Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,129,715 (GRCm39) probably benign Het
Casz1 CACA C 4: 149,036,761 (GRCm39) probably benign Het
Cherp GACCTGGA G 8: 73,215,893 (GRCm39) probably null Het
Chga AGC AGCTGC 12: 102,527,682 (GRCm39) probably benign Het
Coq7 A G 7: 118,132,405 (GRCm39) S24P probably benign Het
Cul1 T C 6: 47,501,515 (GRCm39) V734A possibly damaging Het
Dgkz A T 2: 91,770,286 (GRCm39) F521I possibly damaging Het
Fam171b GCAGCA GCAGCATCAGCA 2: 83,643,230 (GRCm39) probably benign Het
Fat1 T G 8: 45,442,003 (GRCm39) S1102A probably benign Het
Gab3 CTT CTTTTT X: 74,043,624 (GRCm39) probably benign Het
Gm14412 T C 2: 177,008,894 (GRCm39) I52V probably benign Het
Gm5414 T C 15: 101,536,388 (GRCm39) E79G probably benign Het
Grin2b A G 6: 136,021,238 (GRCm39) V21A probably benign Het
Hecw1 C A 13: 14,472,009 (GRCm39) C553F probably damaging Het
Hsd3b6 T A 3: 98,713,756 (GRCm39) H181L probably benign Het
Il2 CCAGGTGCTGCTGC CC 3: 37,179,911 (GRCm39) probably benign Het
Inpp5f G A 7: 128,296,807 (GRCm39) G1053R probably damaging Het
Kcnma1 T G 14: 23,361,765 (GRCm39) Y1142S probably damaging Het
Kctd8 T C 5: 69,267,775 (GRCm39) K445R possibly damaging Het
Kmt2b CC CCTCCTTC 7: 30,285,807 (GRCm39) probably benign Het
Kmt2c TG TGTTGCGG 5: 25,520,773 (GRCm39) probably benign Het
Krtap28-10 CACCAC CACCACCGCCACCGCAACCAC 1: 83,020,003 (GRCm39) probably benign Het
Krtap28-10 GCCACCACAGC GCCACCACAGCCACATCCACCACAGC 1: 83,020,001 (GRCm39) probably benign Het
Lama1 A G 17: 68,059,897 (GRCm39) D662G Het
Lce1m AC ACTGCTGCTGCCCC 3: 92,925,459 (GRCm39) probably benign Het
Lce1m GCTGCCACC GCTGCCACCACTCCTGCCACC 3: 92,925,576 (GRCm39) probably benign Het
Lmo4 A C 3: 143,907,623 (GRCm39) S63A possibly damaging Het
Lrrk2 T C 15: 91,620,836 (GRCm39) I952T probably benign Het
Lyst T C 13: 13,810,426 (GRCm39) F699L probably benign Het
Matn3 T A 12: 9,008,797 (GRCm39) D303E probably benign Het
Me1 A G 9: 86,464,876 (GRCm39) Y545H probably damaging Het
Mettl3 A T 14: 52,537,756 (GRCm39) V68E probably benign Het
Mptx2 T C 1: 173,102,536 (GRCm39) N51S probably benign Het
Mylk A G 16: 34,699,741 (GRCm39) D368G probably benign Het
Myom2 T C 8: 15,131,418 (GRCm39) V372A possibly damaging Het
Neb T C 2: 52,085,433 (GRCm39) D5569G probably damaging Het
P4ha2 CCAGGTG C 11: 54,001,061 (GRCm39) probably benign Het
Pop1 G A 15: 34,502,583 (GRCm39) G90D probably damaging Het
Rbm12 CC CCGGGTATTGTGGGACCAGTTATTGCGGGAGC 2: 155,937,995 (GRCm39) probably benign Het
Sertad4 T C 1: 192,529,486 (GRCm39) Y110C probably damaging Het
Setd1a GGTAGTGGT GGTAGTGGTAGTAGTGGT 7: 127,384,486 (GRCm39) probably benign Het
Smarca2 AGC AGCCCCGGC 19: 26,608,421 (GRCm39) probably benign Het
Smarca2 ACA ACAACAGCA 19: 26,608,386 (GRCm39) probably benign Het
Supt20 AGCA AGCACCCGCA 3: 54,635,083 (GRCm39) probably benign Het
Tcof1 AGC AGCCGC 18: 60,968,811 (GRCm39) probably benign Het
Tecpr1 A G 5: 144,154,204 (GRCm39) F83S probably damaging Het
Vmn1r48 A T 6: 90,013,186 (GRCm39) M213K probably benign Het
Zc3h4 CCC CCCTGACATGCATCC 7: 16,163,612 (GRCm39) probably benign Het
Zscan29 T C 2: 120,994,477 (GRCm39) N503D possibly damaging Het
Other mutations in Gpc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Gpc5 APN 14 115,607,436 (GRCm39) missense probably damaging 1.00
IGL01298:Gpc5 APN 14 115,636,600 (GRCm39) missense probably benign 0.14
IGL01359:Gpc5 APN 14 115,607,162 (GRCm39) missense possibly damaging 0.74
IGL02354:Gpc5 APN 14 115,370,699 (GRCm39) nonsense probably null
IGL02361:Gpc5 APN 14 115,370,699 (GRCm39) nonsense probably null
IGL02982:Gpc5 APN 14 115,607,400 (GRCm39) missense probably damaging 1.00
IGL03120:Gpc5 APN 14 115,607,556 (GRCm39) missense possibly damaging 0.64
R0322:Gpc5 UTSW 14 115,636,563 (GRCm39) missense probably benign 0.05
R0396:Gpc5 UTSW 14 115,665,620 (GRCm39) missense possibly damaging 0.91
R0555:Gpc5 UTSW 14 115,789,740 (GRCm39) missense probably damaging 0.98
R0629:Gpc5 UTSW 14 115,789,651 (GRCm39) missense possibly damaging 0.94
R1536:Gpc5 UTSW 14 115,636,662 (GRCm39) missense probably benign 0.09
R1660:Gpc5 UTSW 14 115,636,691 (GRCm39) missense probably benign 0.12
R1676:Gpc5 UTSW 14 115,607,510 (GRCm39) missense probably damaging 1.00
R2328:Gpc5 UTSW 14 116,025,591 (GRCm39) missense probably damaging 0.99
R3522:Gpc5 UTSW 14 116,761,747 (GRCm39) missense probably benign 0.00
R3776:Gpc5 UTSW 14 115,607,472 (GRCm39) missense probably benign 0.05
R3885:Gpc5 UTSW 14 115,607,472 (GRCm39) missense probably benign 0.05
R3889:Gpc5 UTSW 14 115,607,472 (GRCm39) missense probably benign 0.05
R3893:Gpc5 UTSW 14 115,607,472 (GRCm39) missense probably benign 0.05
R4041:Gpc5 UTSW 14 115,370,628 (GRCm39) missense probably damaging 1.00
R4517:Gpc5 UTSW 14 115,789,651 (GRCm39) missense possibly damaging 0.94
R5068:Gpc5 UTSW 14 115,654,676 (GRCm39) makesense probably null
R5639:Gpc5 UTSW 14 115,330,179 (GRCm39) missense probably benign 0.13
R5730:Gpc5 UTSW 14 116,025,726 (GRCm39) missense possibly damaging 0.73
R5944:Gpc5 UTSW 14 115,607,250 (GRCm39) missense probably benign 0.24
R6351:Gpc5 UTSW 14 115,636,612 (GRCm39) missense probably benign 0.01
R6557:Gpc5 UTSW 14 115,329,966 (GRCm39) unclassified probably benign
R6657:Gpc5 UTSW 14 115,607,610 (GRCm39) missense probably benign 0.01
R6714:Gpc5 UTSW 14 115,789,715 (GRCm39) nonsense probably null
R6751:Gpc5 UTSW 14 115,607,363 (GRCm39) missense probably benign 0.00
R7057:Gpc5 UTSW 14 115,370,654 (GRCm39) missense possibly damaging 0.64
R7142:Gpc5 UTSW 14 115,654,615 (GRCm39) missense probably benign 0.01
R7225:Gpc5 UTSW 14 115,789,710 (GRCm39) missense probably damaging 1.00
R7544:Gpc5 UTSW 14 115,665,585 (GRCm39) missense probably damaging 1.00
R7658:Gpc5 UTSW 14 115,665,620 (GRCm39) missense possibly damaging 0.91
R7695:Gpc5 UTSW 14 115,330,026 (GRCm39) missense unknown
R7785:Gpc5 UTSW 14 115,654,632 (GRCm39) missense probably benign 0.00
R8116:Gpc5 UTSW 14 115,636,637 (GRCm39) missense probably damaging 0.98
R8303:Gpc5 UTSW 14 115,665,667 (GRCm39) missense probably benign 0.01
R8983:Gpc5 UTSW 14 115,330,118 (GRCm39) missense unknown
RF022:Gpc5 UTSW 14 115,789,688 (GRCm39) missense probably damaging 1.00
Z1176:Gpc5 UTSW 14 115,607,376 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04