Incidental Mutation 'RF001:Gpc5'
ID602524
Institutional Source Beutler Lab
Gene Symbol Gpc5
Ensembl Gene ENSMUSG00000022112
Gene Nameglypican 5
SynonymsA230034F01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF001 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location115092215-116525179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115417178 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 470 (S470N)
Ref Sequence ENSEMBL: ENSMUSP00000135857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022707] [ENSMUST00000175665] [ENSMUST00000176912]
Predicted Effect probably benign
Transcript: ENSMUST00000022707
SMART Domains Protein: ENSMUSP00000022707
Gene: ENSMUSG00000022112

DomainStartEndE-ValueType
Pfam:Glypican 9 572 1.8e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175665
AA Change: S470N

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135857
Gene: ENSMUSG00000022112
AA Change: S470N

DomainStartEndE-ValueType
Pfam:Glypican 82 480 1.3e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176912
SMART Domains Protein: ENSMUSP00000135085
Gene: ENSMUSG00000022112

DomainStartEndE-ValueType
Pfam:Glypican 85 642 1.6e-174 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik G GTGGCTGCTA 1: 82,913,590 probably benign Het
Acer1 A G 17: 56,958,909 V122A probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,921 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Atp13a1 C A 8: 69,800,070 A680D probably damaging Het
Blm CGCCTCCTCCTC CGCCTCCTCCTCAGCCTCCTCCTC 7: 80,512,903 probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTCCTCCTCCTCCTC 7: 80,512,906 probably benign Het
Blm CTCCTCC CTCCTCCTCCTCGTCCTCC 7: 80,512,927 probably benign Het
Cad GT G 5: 31,060,212 probably benign Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,141,276 probably benign Het
Casz1 CACA C 4: 148,952,304 probably benign Het
Cherp GACCTGGA G 8: 72,462,049 probably null Het
Chga AGC AGCTGC 12: 102,561,423 probably benign Het
Coq7 A G 7: 118,533,182 S24P probably benign Het
Cul1 T C 6: 47,524,581 V734A possibly damaging Het
Cyb5r4 GCCCAGGGATGTGACAGACACACT GCCCAGGGATGTGACAGACACACTCCCCAGGGATGTGACAGACACACT 9: 87,040,416 probably benign Het
Dgkz A T 2: 91,939,941 F521I possibly damaging Het
Fam171b GCAGCA GCAGCATCAGCA 2: 83,812,886 probably benign Het
Fat1 T G 8: 44,988,966 S1102A probably benign Het
Gab3 CTT CTTTTT X: 75,000,018 probably benign Het
Gm14412 T C 2: 177,317,101 I52V probably benign Het
Gm5346 T G 8: 43,626,905 D94A possibly damaging Het
Gm5414 T C 15: 101,627,953 E79G probably benign Het
Grin2b A G 6: 136,044,240 V21A probably benign Het
Hecw1 C A 13: 14,297,424 C553F probably damaging Het
Hsd3b6 T A 3: 98,806,440 H181L probably benign Het
Il2 CCAGGTGCTGCTGC CC 3: 37,125,762 probably benign Het
Inpp5f G A 7: 128,695,083 G1053R probably damaging Het
Kcnma1 T G 14: 23,311,697 Y1142S probably damaging Het
Kctd8 T C 5: 69,110,432 K445R possibly damaging Het
Kmt2b CC CCTCCTTC 7: 30,586,382 probably benign Het
Kmt2c TG TGTTGCGG 5: 25,315,775 probably benign Het
Krtap28-10 CACAGCCACAGCCACCACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCACCACAGCCACAGCCAC 1: 83,042,255 probably benign Het
Krtap28-10 GCCACCACAGC GCCACCACAGCCACATCCACCACAGC 1: 83,042,280 probably benign Het
Krtap28-10 CACCAC CACCACCGCCACCGCAACCAC 1: 83,042,282 probably benign Het
Lama1 A G 17: 67,752,902 D662G Het
Lce1m AC ACTGCTGCTGCCCC 3: 93,018,152 probably benign Het
Lce1m GCTGCCACC GCTGCCACCACTCCTGCCACC 3: 93,018,269 probably benign Het
Lmo4 A C 3: 144,201,862 S63A possibly damaging Het
Lrrk2 T C 15: 91,736,633 I952T probably benign Het
Lyst T C 13: 13,635,841 F699L probably benign Het
Matn3 T A 12: 8,958,797 D303E probably benign Het
Me1 A G 9: 86,582,823 Y545H probably damaging Het
Mettl3 A T 14: 52,300,299 V68E probably benign Het
Mptx2 T C 1: 173,274,969 N51S probably benign Het
Mylk A G 16: 34,879,371 D368G probably benign Het
Myom2 T C 8: 15,081,418 V372A possibly damaging Het
Neb T C 2: 52,195,421 D5569G probably damaging Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGCGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,030 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Rbm12 CC CCGGGTATTGTGGGACCAGTTATTGCGGGAGC 2: 156,096,075 probably benign Het
Sertad4 T C 1: 192,847,178 Y110C probably damaging Het
Setd1a GGTAGTGGT GGTAGTGGTAGTAGTGGT 7: 127,785,314 probably benign Het
Smarca2 ACA ACAACAGCA 19: 26,630,986 probably benign Het
Smarca2 AGC AGCCCCGGC 19: 26,631,021 probably benign Het
Supt20 AGCA AGCACCCGCA 3: 54,727,662 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tecpr1 A G 5: 144,217,386 F83S probably damaging Het
Triobp GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA 15: 78,967,027 probably benign Het
Vmn1r48 A T 6: 90,036,204 M213K probably benign Het
Zc3h4 CCC CCCTGACATGCATCC 7: 16,429,687 probably benign Het
Zscan29 T C 2: 121,163,996 N503D possibly damaging Het
Other mutations in Gpc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Gpc5 APN 14 115370024 missense probably damaging 1.00
IGL01298:Gpc5 APN 14 115399188 missense probably benign 0.14
IGL01359:Gpc5 APN 14 115369750 missense possibly damaging 0.74
IGL02354:Gpc5 APN 14 115133287 nonsense probably null
IGL02361:Gpc5 APN 14 115133287 nonsense probably null
IGL02982:Gpc5 APN 14 115369988 missense probably damaging 1.00
IGL03120:Gpc5 APN 14 115370144 missense possibly damaging 0.64
R0322:Gpc5 UTSW 14 115399151 missense probably benign 0.05
R0396:Gpc5 UTSW 14 115428208 missense possibly damaging 0.91
R0555:Gpc5 UTSW 14 115552328 missense probably damaging 0.98
R0629:Gpc5 UTSW 14 115552239 missense possibly damaging 0.94
R1536:Gpc5 UTSW 14 115399250 missense probably benign 0.09
R1660:Gpc5 UTSW 14 115399279 missense probably benign 0.12
R1676:Gpc5 UTSW 14 115370098 missense probably damaging 1.00
R2328:Gpc5 UTSW 14 115788179 missense probably damaging 0.99
R3522:Gpc5 UTSW 14 116524335 missense probably benign 0.00
R3776:Gpc5 UTSW 14 115370060 missense probably benign 0.05
R3885:Gpc5 UTSW 14 115370060 missense probably benign 0.05
R3889:Gpc5 UTSW 14 115370060 missense probably benign 0.05
R3893:Gpc5 UTSW 14 115370060 missense probably benign 0.05
R4041:Gpc5 UTSW 14 115133216 missense probably damaging 1.00
R4517:Gpc5 UTSW 14 115552239 missense possibly damaging 0.94
R5068:Gpc5 UTSW 14 115417264 makesense probably null
R5639:Gpc5 UTSW 14 115092747 missense probably benign 0.13
R5730:Gpc5 UTSW 14 115788314 missense possibly damaging 0.73
R5944:Gpc5 UTSW 14 115369838 missense probably benign 0.24
R6351:Gpc5 UTSW 14 115399200 missense probably benign 0.01
R6557:Gpc5 UTSW 14 115092534 unclassified probably benign
R6657:Gpc5 UTSW 14 115370198 missense probably benign 0.01
R6714:Gpc5 UTSW 14 115552303 nonsense probably null
R6751:Gpc5 UTSW 14 115369951 missense probably benign 0.00
R7057:Gpc5 UTSW 14 115133242 missense possibly damaging 0.64
R7142:Gpc5 UTSW 14 115417203 missense probably benign 0.01
R7225:Gpc5 UTSW 14 115552298 missense probably damaging 1.00
R7544:Gpc5 UTSW 14 115428173 missense probably damaging 1.00
R7658:Gpc5 UTSW 14 115428208 missense possibly damaging 0.91
R7695:Gpc5 UTSW 14 115092594 missense unknown
R7785:Gpc5 UTSW 14 115417220 missense probably benign 0.00
R8116:Gpc5 UTSW 14 115399225 missense probably damaging 0.98
R8303:Gpc5 UTSW 14 115428255 missense probably benign 0.01
RF022:Gpc5 UTSW 14 115552276 missense probably damaging 1.00
Z1176:Gpc5 UTSW 14 115369964 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGATCTTCTAACTTTCCACTGCATG -3'
(R):5'- CAGAAATTGTAGCTGCTACATAACC -3'

Sequencing Primer
(F):5'- TGGGTTGTCCACACCCATAG -3'
(R):5'- ATGTAAAGTGAGTCCGTAGTCTGAC -3'
Posted On2019-12-04