Incidental Mutation 'RF001:Pop1'
ID 602525
Institutional Source Beutler Lab
Gene Symbol Pop1
Ensembl Gene ENSMUSG00000022325
Gene Name processing of precursor 1, ribonuclease P/MRP family, (S. cerevisiae)
Synonyms 4932434G09Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock # RF001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 34495304-34530648 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 34502437 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 90 (G90D)
Ref Sequence ENSEMBL: ENSMUSP00000052654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052290] [ENSMUST00000079028]
AlphaFold Q8K205
Predicted Effect probably damaging
Transcript: ENSMUST00000052290
AA Change: G90D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052654
Gene: ENSMUSG00000022325
AA Change: G90D

DomainStartEndE-ValueType
Pfam:POP1 107 190 6.2e-21 PFAM
Pfam:POP1 179 257 2.5e-23 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 647 738 1.4e-30 PFAM
low complexity region 931 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079028
AA Change: G90D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078037
Gene: ENSMUSG00000022325
AA Change: G90D

DomainStartEndE-ValueType
Pfam:POP1 107 258 1e-46 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 617 708 1.2e-34 PFAM
low complexity region 901 910 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the protein subunit of two different small nucleolar ribonucleoprotein complexes: the endoribonuclease for mitochondrial RNA processing complex and the ribonuclease P complex. The encoded protein is a ribonuclease that localizes to the nucleus and functions in pre-RNA processing. This protein is also an autoantigen in patients suffering from connective tissue diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik G GTGGCTGCTA 1: 82,913,590 probably benign Het
Acer1 A G 17: 56,958,909 V122A probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,921 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Atp13a1 C A 8: 69,800,070 A680D probably damaging Het
Blm CGCCTCCTCCTC CGCCTCCTCCTCAGCCTCCTCCTC 7: 80,512,903 probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTCCTCCTCCTCCTC 7: 80,512,906 probably benign Het
Blm CTCCTCC CTCCTCCTCCTCGTCCTCC 7: 80,512,927 probably benign Het
Cad GT G 5: 31,060,212 probably benign Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,141,276 probably benign Het
Casz1 CACA C 4: 148,952,304 probably benign Het
Cherp GACCTGGA G 8: 72,462,049 probably null Het
Chga AGC AGCTGC 12: 102,561,423 probably benign Het
Coq7 A G 7: 118,533,182 S24P probably benign Het
Cul1 T C 6: 47,524,581 V734A possibly damaging Het
Cyb5r4 GCCCAGGGATGTGACAGACACACT GCCCAGGGATGTGACAGACACACTCCCCAGGGATGTGACAGACACACT 9: 87,040,416 probably benign Het
Dgkz A T 2: 91,939,941 F521I possibly damaging Het
Fam171b GCAGCA GCAGCATCAGCA 2: 83,812,886 probably benign Het
Fat1 T G 8: 44,988,966 S1102A probably benign Het
Gab3 CTT CTTTTT X: 75,000,018 probably benign Het
Gm14412 T C 2: 177,317,101 I52V probably benign Het
Gm5346 T G 8: 43,626,905 D94A possibly damaging Het
Gm5414 T C 15: 101,627,953 E79G probably benign Het
Gpc5 G A 14: 115,417,178 S470N probably benign Het
Grin2b A G 6: 136,044,240 V21A probably benign Het
Hecw1 C A 13: 14,297,424 C553F probably damaging Het
Hsd3b6 T A 3: 98,806,440 H181L probably benign Het
Il2 CCAGGTGCTGCTGC CC 3: 37,125,762 probably benign Het
Inpp5f G A 7: 128,695,083 G1053R probably damaging Het
Kcnma1 T G 14: 23,311,697 Y1142S probably damaging Het
Kctd8 T C 5: 69,110,432 K445R possibly damaging Het
Kmt2b CC CCTCCTTC 7: 30,586,382 probably benign Het
Kmt2c TG TGTTGCGG 5: 25,315,775 probably benign Het
Krtap28-10 CACAGCCACAGCCACCACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCACCACAGCCACAGCCAC 1: 83,042,255 probably benign Het
Krtap28-10 GCCACCACAGC GCCACCACAGCCACATCCACCACAGC 1: 83,042,280 probably benign Het
Krtap28-10 CACCAC CACCACCGCCACCGCAACCAC 1: 83,042,282 probably benign Het
Lama1 A G 17: 67,752,902 D662G Het
Lce1m AC ACTGCTGCTGCCCC 3: 93,018,152 probably benign Het
Lce1m GCTGCCACC GCTGCCACCACTCCTGCCACC 3: 93,018,269 probably benign Het
Lmo4 A C 3: 144,201,862 S63A possibly damaging Het
Lrrk2 T C 15: 91,736,633 I952T probably benign Het
Lyst T C 13: 13,635,841 F699L probably benign Het
Matn3 T A 12: 8,958,797 D303E probably benign Het
Me1 A G 9: 86,582,823 Y545H probably damaging Het
Mettl3 A T 14: 52,300,299 V68E probably benign Het
Mptx2 T C 1: 173,274,969 N51S probably benign Het
Mylk A G 16: 34,879,371 D368G probably benign Het
Myom2 T C 8: 15,081,418 V372A possibly damaging Het
Neb T C 2: 52,195,421 D5569G probably damaging Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGCGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,030 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Rbm12 CC CCGGGTATTGTGGGACCAGTTATTGCGGGAGC 2: 156,096,075 probably benign Het
Sertad4 T C 1: 192,847,178 Y110C probably damaging Het
Setd1a GGTAGTGGT GGTAGTGGTAGTAGTGGT 7: 127,785,314 probably benign Het
Smarca2 ACA ACAACAGCA 19: 26,630,986 probably benign Het
Smarca2 AGC AGCCCCGGC 19: 26,631,021 probably benign Het
Supt20 AGCA AGCACCCGCA 3: 54,727,662 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tecpr1 A G 5: 144,217,386 F83S probably damaging Het
Triobp GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA 15: 78,967,027 probably benign Het
Vmn1r48 A T 6: 90,036,204 M213K probably benign Het
Zc3h4 CCC CCCTGACATGCATCC 7: 16,429,687 probably benign Het
Zscan29 T C 2: 121,163,996 N503D possibly damaging Het
Other mutations in Pop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Pop1 APN 15 34508729 missense probably benign 0.00
IGL02192:Pop1 APN 15 34529071 missense probably benign 0.08
IGL02680:Pop1 APN 15 34502473 missense probably damaging 0.99
IGL02958:Pop1 APN 15 34530363 missense probably damaging 0.99
H8562:Pop1 UTSW 15 34530212 missense probably benign 0.00
PIT4802001:Pop1 UTSW 15 34529083 missense probably benign 0.00
R0244:Pop1 UTSW 15 34515891 nonsense probably null
R0281:Pop1 UTSW 15 34529858 splice site probably null
R0453:Pop1 UTSW 15 34526206 missense possibly damaging 0.82
R0579:Pop1 UTSW 15 34509969 missense possibly damaging 0.68
R1054:Pop1 UTSW 15 34509809 missense probably benign 0.30
R1501:Pop1 UTSW 15 34510357 missense probably benign 0.01
R1614:Pop1 UTSW 15 34530210 missense possibly damaging 0.46
R1994:Pop1 UTSW 15 34530471 missense probably damaging 1.00
R2084:Pop1 UTSW 15 34508598 splice site probably benign
R4020:Pop1 UTSW 15 34508780 missense probably benign 0.01
R4550:Pop1 UTSW 15 34528936 missense probably damaging 1.00
R4579:Pop1 UTSW 15 34515824 intron probably benign
R5672:Pop1 UTSW 15 34530179 missense possibly damaging 0.63
R6139:Pop1 UTSW 15 34529058 missense probably benign 0.26
R6161:Pop1 UTSW 15 34526310 missense probably damaging 1.00
R6821:Pop1 UTSW 15 34508639 missense possibly damaging 0.86
R7053:Pop1 UTSW 15 34530275 missense probably benign 0.01
R7195:Pop1 UTSW 15 34510379 missense probably damaging 0.97
R7543:Pop1 UTSW 15 34530447 missense probably damaging 1.00
R7571:Pop1 UTSW 15 34528947 missense probably null 1.00
R7587:Pop1 UTSW 15 34502413 missense probably damaging 0.97
R8401:Pop1 UTSW 15 34508609 missense probably damaging 1.00
R8406:Pop1 UTSW 15 34529170 missense probably benign
R8707:Pop1 UTSW 15 34529203 missense probably benign 0.02
R9044:Pop1 UTSW 15 34530408 missense possibly damaging 0.94
R9066:Pop1 UTSW 15 34515914 missense possibly damaging 0.68
R9236:Pop1 UTSW 15 34499412 missense probably damaging 0.98
RF002:Pop1 UTSW 15 34502437 missense probably damaging 1.00
Z1088:Pop1 UTSW 15 34499319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAACTCACAGGTTGGCTCTAG -3'
(R):5'- CGCAATAGTCAAAGCCCAGG -3'

Sequencing Primer
(F):5'- ACTCACAGGTTGGCTCTAGAGTTAAG -3'
(R):5'- CCCAGGAGAGAGGTGAGCC -3'
Posted On 2019-12-04