Incidental Mutation 'RF001:Lama1'
ID602531
Institutional Source Beutler Lab
Gene Symbol Lama1
Ensembl Gene ENSMUSG00000032796
Gene Namelaminin, alpha 1
SynonymsLama
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF001 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location67697265-67822645 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67752902 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 662 (D662G)
Ref Sequence ENSEMBL: ENSMUSP00000043957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035471]
Predicted Effect
SMART Domains Protein: ENSMUSP00000043957
Gene: ENSMUSG00000032796
AA Change: D662G

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
LamNT 23 275 1.2e-131 SMART
EGF_Lam 277 331 1e-5 SMART
EGF_Lam 334 401 6.6e-6 SMART
EGF_Lam 404 458 9.11e-9 SMART
EGF_Lam 461 507 8.12e-6 SMART
LamB 570 702 2.09e-57 SMART
EGF_like 715 746 3.36e0 SMART
EGF_Lam 749 795 7.01e-10 SMART
EGF_Lam 798 853 3.59e-7 SMART
EGF_Lam 856 906 1.53e-10 SMART
EGF_Lam 909 955 1.13e-13 SMART
EGF_Lam 958 1002 1.36e-7 SMART
EGF_Lam 1005 1048 7.29e-8 SMART
EGF_like 1034 1082 4.83e1 SMART
EGF_Lam 1051 1094 1.67e-7 SMART
EGF_Lam 1097 1154 1.32e-5 SMART
LamB 1220 1352 8.7e-46 SMART
Pfam:Laminin_EGF 1367 1397 1.7e-6 PFAM
EGF_Lam 1410 1456 7.12e-11 SMART
EGF_Lam 1459 1513 3.25e-5 SMART
EGF_like 1497 1547 6.41e1 SMART
EGF_Lam 1516 1560 1.71e-13 SMART
Pfam:Laminin_I 1574 1838 1.7e-91 PFAM
low complexity region 2012 2031 N/A INTRINSIC
low complexity region 2087 2098 N/A INTRINSIC
LamG 2145 2287 3.66e-30 SMART
LamG 2332 2473 5.98e-35 SMART
LamG 2513 2661 1.11e-29 SMART
low complexity region 2695 2708 N/A INTRINSIC
LamG 2743 2877 9.72e-35 SMART
LamG 2920 3056 4.63e-41 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the alpha 1 subunits of laminin. The laminins are a family of extracellular matrix glycoproteins that have a heterotrimeric structure consisting of an alpha, beta and gamma chain. These proteins make up a major component of the basement membrane and have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Mutations in this gene may be associated with Poretti-Boltshauser syndrome. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation with impaired formation of Reichert's membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik G GTGGCTGCTA 1: 82,913,590 probably benign Het
Acer1 A G 17: 56,958,909 V122A probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,921 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Atp13a1 C A 8: 69,800,070 A680D probably damaging Het
Blm CGCCTCCTCCTC CGCCTCCTCCTCAGCCTCCTCCTC 7: 80,512,903 probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTCCTCCTCCTCCTC 7: 80,512,906 probably benign Het
Blm CTCCTCC CTCCTCCTCCTCGTCCTCC 7: 80,512,927 probably benign Het
Cad GT G 5: 31,060,212 probably benign Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,141,276 probably benign Het
Casz1 CACA C 4: 148,952,304 probably benign Het
Cherp GACCTGGA G 8: 72,462,049 probably null Het
Chga AGC AGCTGC 12: 102,561,423 probably benign Het
Coq7 A G 7: 118,533,182 S24P probably benign Het
Cul1 T C 6: 47,524,581 V734A possibly damaging Het
Cyb5r4 GCCCAGGGATGTGACAGACACACT GCCCAGGGATGTGACAGACACACTCCCCAGGGATGTGACAGACACACT 9: 87,040,416 probably benign Het
Dgkz A T 2: 91,939,941 F521I possibly damaging Het
Fam171b GCAGCA GCAGCATCAGCA 2: 83,812,886 probably benign Het
Fat1 T G 8: 44,988,966 S1102A probably benign Het
Gab3 CTT CTTTTT X: 75,000,018 probably benign Het
Gm14412 T C 2: 177,317,101 I52V probably benign Het
Gm5346 T G 8: 43,626,905 D94A possibly damaging Het
Gm5414 T C 15: 101,627,953 E79G probably benign Het
Gpc5 G A 14: 115,417,178 S470N probably benign Het
Grin2b A G 6: 136,044,240 V21A probably benign Het
Hecw1 C A 13: 14,297,424 C553F probably damaging Het
Hsd3b6 T A 3: 98,806,440 H181L probably benign Het
Il2 CCAGGTGCTGCTGC CC 3: 37,125,762 probably benign Het
Inpp5f G A 7: 128,695,083 G1053R probably damaging Het
Kcnma1 T G 14: 23,311,697 Y1142S probably damaging Het
Kctd8 T C 5: 69,110,432 K445R possibly damaging Het
Kmt2b CC CCTCCTTC 7: 30,586,382 probably benign Het
Kmt2c TG TGTTGCGG 5: 25,315,775 probably benign Het
Krtap28-10 CACAGCCACAGCCACCACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCACCACAGCCACAGCCAC 1: 83,042,255 probably benign Het
Krtap28-10 GCCACCACAGC GCCACCACAGCCACATCCACCACAGC 1: 83,042,280 probably benign Het
Krtap28-10 CACCAC CACCACCGCCACCGCAACCAC 1: 83,042,282 probably benign Het
Lce1m AC ACTGCTGCTGCCCC 3: 93,018,152 probably benign Het
Lce1m GCTGCCACC GCTGCCACCACTCCTGCCACC 3: 93,018,269 probably benign Het
Lmo4 A C 3: 144,201,862 S63A possibly damaging Het
Lrrk2 T C 15: 91,736,633 I952T probably benign Het
Lyst T C 13: 13,635,841 F699L probably benign Het
Matn3 T A 12: 8,958,797 D303E probably benign Het
Me1 A G 9: 86,582,823 Y545H probably damaging Het
Mettl3 A T 14: 52,300,299 V68E probably benign Het
Mptx2 T C 1: 173,274,969 N51S probably benign Het
Mylk A G 16: 34,879,371 D368G probably benign Het
Myom2 T C 8: 15,081,418 V372A possibly damaging Het
Neb T C 2: 52,195,421 D5569G probably damaging Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGCGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,030 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Rbm12 CC CCGGGTATTGTGGGACCAGTTATTGCGGGAGC 2: 156,096,075 probably benign Het
Sertad4 T C 1: 192,847,178 Y110C probably damaging Het
Setd1a GGTAGTGGT GGTAGTGGTAGTAGTGGT 7: 127,785,314 probably benign Het
Smarca2 ACA ACAACAGCA 19: 26,630,986 probably benign Het
Smarca2 AGC AGCCCCGGC 19: 26,631,021 probably benign Het
Supt20 AGCA AGCACCCGCA 3: 54,727,662 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tecpr1 A G 5: 144,217,386 F83S probably damaging Het
Triobp GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA GCGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACAGCCCCAGGACTCCCTGTGCCCAACGGGACA 15: 78,967,027 probably benign Het
Vmn1r48 A T 6: 90,036,204 M213K probably benign Het
Zc3h4 CCC CCCTGACATGCATCC 7: 16,429,687 probably benign Het
Zscan29 T C 2: 121,163,996 N503D possibly damaging Het
Other mutations in Lama1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Lama1 APN 17 67815928 missense probably benign
IGL00336:Lama1 APN 17 67813948 missense probably benign 0.07
IGL01066:Lama1 APN 17 67743326 missense probably damaging 1.00
IGL01140:Lama1 APN 17 67802933 missense probably benign 0.14
IGL01291:Lama1 APN 17 67738870 missense probably damaging 1.00
IGL01296:Lama1 APN 17 67745051 missense probably benign 0.27
IGL01317:Lama1 APN 17 67818701 missense probably damaging 1.00
IGL01490:Lama1 APN 17 67750584 missense possibly damaging 0.54
IGL01506:Lama1 APN 17 67785070 missense probably benign 0.01
IGL01508:Lama1 APN 17 67809361 splice site probably benign
IGL01522:Lama1 APN 17 67752774 splice site probably benign
IGL01530:Lama1 APN 17 67796790 missense probably benign 0.02
IGL01541:Lama1 APN 17 67785070 missense probably benign 0.01
IGL01677:Lama1 APN 17 67779148 missense probably benign 0.15
IGL01886:Lama1 APN 17 67807797 missense probably benign 0.36
IGL01994:Lama1 APN 17 67752439 missense probably benign 0.05
IGL02017:Lama1 APN 17 67764725 missense probably benign 0.00
IGL02021:Lama1 APN 17 67821626 missense probably damaging 1.00
IGL02026:Lama1 APN 17 67809292 missense possibly damaging 0.82
IGL02044:Lama1 APN 17 67811490 missense probably benign 0.01
IGL02120:Lama1 APN 17 67716789 missense probably damaging 1.00
IGL02425:Lama1 APN 17 67811485 missense probably benign 0.45
IGL02549:Lama1 APN 17 67790835 missense possibly damaging 0.93
IGL02642:Lama1 APN 17 67812366 missense probably benign 0.00
IGL02795:Lama1 APN 17 67738894 splice site probably null
IGL02798:Lama1 APN 17 67795191 splice site probably benign
IGL02863:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02870:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02876:Lama1 APN 17 67750692 critical splice donor site probably null
IGL02885:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02891:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02978:Lama1 APN 17 67786081 nonsense probably null
IGL03064:Lama1 APN 17 67779104 missense probably benign 0.01
IGL03076:Lama1 APN 17 67716799 missense possibly damaging 0.95
IGL03110:Lama1 APN 17 67798986 missense probably benign 0.04
IGL03143:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL03159:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL03268:Lama1 APN 17 67804536 missense probably damaging 0.99
ANU05:Lama1 UTSW 17 67738870 missense probably damaging 1.00
PIT4472001:Lama1 UTSW 17 67764704 missense
R0047:Lama1 UTSW 17 67795186 splice site probably benign
R0047:Lama1 UTSW 17 67795186 splice site probably benign
R0050:Lama1 UTSW 17 67782056 missense possibly damaging 0.66
R0096:Lama1 UTSW 17 67805413 missense probably benign 0.12
R0096:Lama1 UTSW 17 67805413 missense probably benign 0.12
R0111:Lama1 UTSW 17 67737498 missense probably damaging 0.98
R0116:Lama1 UTSW 17 67776923 missense probably benign 0.10
R0121:Lama1 UTSW 17 67798513 splice site probably benign
R0278:Lama1 UTSW 17 67810183 missense probably null 0.98
R0281:Lama1 UTSW 17 67817569 missense probably damaging 1.00
R0312:Lama1 UTSW 17 67775851 missense possibly damaging 0.45
R0419:Lama1 UTSW 17 67791610 critical splice donor site probably null
R0512:Lama1 UTSW 17 67779134 missense possibly damaging 0.67
R0514:Lama1 UTSW 17 67764698 missense probably benign 0.40
R0562:Lama1 UTSW 17 67815959 missense probably damaging 1.00
R0632:Lama1 UTSW 17 67752368 splice site probably benign
R0645:Lama1 UTSW 17 67773712 missense probably benign 0.01
R0712:Lama1 UTSW 17 67779042 splice site probably null
R0763:Lama1 UTSW 17 67772818 missense probably damaging 0.97
R0941:Lama1 UTSW 17 67775865 missense probably benign 0.10
R1025:Lama1 UTSW 17 67752898 missense probably benign 0.00
R1084:Lama1 UTSW 17 67804469 missense probably benign 0.12
R1103:Lama1 UTSW 17 67790947 missense probably damaging 0.98
R1420:Lama1 UTSW 17 67790947 missense probably damaging 0.98
R1430:Lama1 UTSW 17 67782155 missense possibly damaging 0.95
R1569:Lama1 UTSW 17 67780618 splice site probably null
R1575:Lama1 UTSW 17 67810409 missense possibly damaging 0.96
R1613:Lama1 UTSW 17 67807923 missense probably benign 0.42
R1620:Lama1 UTSW 17 67767033 missense probably benign 0.01
R1629:Lama1 UTSW 17 67805428 missense probably benign 0.00
R1645:Lama1 UTSW 17 67737682 missense probably benign 0.14
R1652:Lama1 UTSW 17 67807846 missense probably damaging 0.97
R1674:Lama1 UTSW 17 67791244 missense probably benign
R1678:Lama1 UTSW 17 67810155 missense possibly damaging 0.56
R1710:Lama1 UTSW 17 67753791 missense probably benign 0.00
R1712:Lama1 UTSW 17 67717186 missense possibly damaging 0.95
R1737:Lama1 UTSW 17 67802921 missense probably benign 0.36
R1757:Lama1 UTSW 17 67763836 missense probably benign 0.40
R1757:Lama1 UTSW 17 67697383 missense unknown
R1813:Lama1 UTSW 17 67791223 missense probably benign
R1896:Lama1 UTSW 17 67791223 missense probably benign
R1945:Lama1 UTSW 17 67745853 missense probably benign 0.14
R2086:Lama1 UTSW 17 67817623 missense probably damaging 1.00
R2149:Lama1 UTSW 17 67773865 missense possibly damaging 0.95
R2178:Lama1 UTSW 17 67769515 missense probably benign 0.07
R2183:Lama1 UTSW 17 67791009 missense probably damaging 0.98
R2197:Lama1 UTSW 17 67752941 missense probably benign 0.02
R2213:Lama1 UTSW 17 67777034 nonsense probably null
R2260:Lama1 UTSW 17 67737507 missense probably damaging 0.96
R2356:Lama1 UTSW 17 67810114 missense probably damaging 1.00
R2420:Lama1 UTSW 17 67750553 missense probably benign 0.00
R2421:Lama1 UTSW 17 67750553 missense probably benign 0.00
R2422:Lama1 UTSW 17 67750553 missense probably benign 0.00
R2424:Lama1 UTSW 17 67798665 missense probably benign 0.09
R2442:Lama1 UTSW 17 67768317 missense probably benign 0.04
R3147:Lama1 UTSW 17 67737658 missense probably damaging 0.98
R3414:Lama1 UTSW 17 67737603 missense probably damaging 1.00
R3683:Lama1 UTSW 17 67768333 missense probably benign 0.40
R3820:Lama1 UTSW 17 67779046 splice site probably null
R3821:Lama1 UTSW 17 67779046 splice site probably null
R3822:Lama1 UTSW 17 67779046 splice site probably null
R4012:Lama1 UTSW 17 67812373 nonsense probably null
R4113:Lama1 UTSW 17 67764703 missense probably benign 0.01
R4133:Lama1 UTSW 17 67750655 missense probably damaging 0.98
R4133:Lama1 UTSW 17 67812486 missense probably damaging 1.00
R4259:Lama1 UTSW 17 67752418 missense possibly damaging 0.95
R4278:Lama1 UTSW 17 67791517 missense probably null 0.00
R4321:Lama1 UTSW 17 67771083 missense probably benign 0.03
R4374:Lama1 UTSW 17 67804518 missense probably benign 0.00
R4386:Lama1 UTSW 17 67773712 missense probably benign 0.01
R4463:Lama1 UTSW 17 67761700 missense probably damaging 1.00
R4629:Lama1 UTSW 17 67805360 critical splice acceptor site probably null
R4630:Lama1 UTSW 17 67794300 missense probably benign 0.00
R4633:Lama1 UTSW 17 67798584 missense probably damaging 0.96
R4668:Lama1 UTSW 17 67752434 missense probably benign 0.27
R4684:Lama1 UTSW 17 67773778 missense possibly damaging 0.88
R4745:Lama1 UTSW 17 67738780 missense probably damaging 1.00
R4786:Lama1 UTSW 17 67773859 missense possibly damaging 0.77
R4797:Lama1 UTSW 17 67716775 missense probably benign 0.04
R4803:Lama1 UTSW 17 67809271 missense probably damaging 1.00
R4925:Lama1 UTSW 17 67794314 missense probably benign 0.02
R4939:Lama1 UTSW 17 67737475 missense possibly damaging 0.91
R4952:Lama1 UTSW 17 67767566 critical splice donor site probably null
R4975:Lama1 UTSW 17 67738834 missense possibly damaging 0.95
R4977:Lama1 UTSW 17 67737682 missense probably damaging 1.00
R5039:Lama1 UTSW 17 67745893 missense possibly damaging 0.66
R5047:Lama1 UTSW 17 67743281 nonsense probably null
R5195:Lama1 UTSW 17 67764800 missense probably benign 0.13
R5230:Lama1 UTSW 17 67745083 nonsense probably null
R5236:Lama1 UTSW 17 67804492 missense probably benign 0.24
R5254:Lama1 UTSW 17 67756716 missense probably benign 0.01
R5345:Lama1 UTSW 17 67817563 missense probably benign
R5438:Lama1 UTSW 17 67800774 missense possibly damaging 0.92
R5521:Lama1 UTSW 17 67780894 nonsense probably null
R5568:Lama1 UTSW 17 67768298 critical splice acceptor site probably null
R5645:Lama1 UTSW 17 67802948 missense probably damaging 1.00
R5665:Lama1 UTSW 17 67770987 missense probably damaging 1.00
R5727:Lama1 UTSW 17 67815224 missense possibly damaging 0.81
R5757:Lama1 UTSW 17 67738787 missense possibly damaging 0.59
R5795:Lama1 UTSW 17 67796727 missense probably benign 0.02
R5857:Lama1 UTSW 17 67807843 missense probably damaging 0.99
R5894:Lama1 UTSW 17 67779047 critical splice acceptor site probably null
R5974:Lama1 UTSW 17 67773727 missense probably benign 0.31
R6032:Lama1 UTSW 17 67750643 missense probably benign 0.01
R6032:Lama1 UTSW 17 67750643 missense probably benign 0.01
R6120:Lama1 UTSW 17 67780617 critical splice donor site probably null
R6219:Lama1 UTSW 17 67790856 missense probably benign 0.08
R6224:Lama1 UTSW 17 67802987 missense possibly damaging 0.56
R6249:Lama1 UTSW 17 67798604 missense probably benign
R6265:Lama1 UTSW 17 67750655 missense probably damaging 0.98
R6276:Lama1 UTSW 17 67784088 splice site probably null
R6284:Lama1 UTSW 17 67810096 missense probably damaging 0.99
R6337:Lama1 UTSW 17 67786019 missense probably benign 0.27
R6414:Lama1 UTSW 17 67746910 critical splice donor site probably null
R6631:Lama1 UTSW 17 67774482 missense probably benign 0.21
R6659:Lama1 UTSW 17 67818635 missense probably damaging 1.00
R6660:Lama1 UTSW 17 67804500 missense probably benign 0.05
R6677:Lama1 UTSW 17 67795233 missense probably benign 0.14
R6763:Lama1 UTSW 17 67746873 missense unknown
R6787:Lama1 UTSW 17 67784025 missense unknown
R6831:Lama1 UTSW 17 67756754 missense possibly damaging 0.89
R6855:Lama1 UTSW 17 67782155 missense possibly damaging 0.95
R6910:Lama1 UTSW 17 67791464 missense possibly damaging 0.60
R6934:Lama1 UTSW 17 67774543 missense probably benign 0.04
R6945:Lama1 UTSW 17 67813866 missense
R6984:Lama1 UTSW 17 67779112 missense
R6989:Lama1 UTSW 17 67753758 missense
R6994:Lama1 UTSW 17 67753825 missense
R6995:Lama1 UTSW 17 67753825 missense
R7035:Lama1 UTSW 17 67781049 missense
R7133:Lama1 UTSW 17 67782146 missense
R7172:Lama1 UTSW 17 67804545 missense
R7197:Lama1 UTSW 17 67737705 nonsense probably null
R7217:Lama1 UTSW 17 67764673 missense
R7229:Lama1 UTSW 17 67752446 missense
R7264:Lama1 UTSW 17 67743297 missense
R7311:Lama1 UTSW 17 67767385 missense
R7394:Lama1 UTSW 17 67717261 missense
R7419:Lama1 UTSW 17 67717174 missense
R7460:Lama1 UTSW 17 67767018 missense
R7492:Lama1 UTSW 17 67817651 missense
R7494:Lama1 UTSW 17 67811446 missense
R7552:Lama1 UTSW 17 67737667 missense
R7576:Lama1 UTSW 17 67782041 missense
R7583:Lama1 UTSW 17 67761621 missense
R7649:Lama1 UTSW 17 67737554 missense
R7663:Lama1 UTSW 17 67780880 missense
R7667:Lama1 UTSW 17 67780597 missense
R7688:Lama1 UTSW 17 67761628 missense
R7693:Lama1 UTSW 17 67817031 missense
R7748:Lama1 UTSW 17 67750590 missense
R7778:Lama1 UTSW 17 67804473 missense
R7824:Lama1 UTSW 17 67804473 missense
R7861:Lama1 UTSW 17 67809221 missense
R7884:Lama1 UTSW 17 67769435 missense
R7944:Lama1 UTSW 17 67809221 missense
R7967:Lama1 UTSW 17 67769435 missense
RF013:Lama1 UTSW 17 67781062 missense
V8831:Lama1 UTSW 17 67752883 missense probably benign 0.00
X0024:Lama1 UTSW 17 67738888 missense probably damaging 1.00
X0028:Lama1 UTSW 17 67767422 missense probably benign 0.00
X0028:Lama1 UTSW 17 67794310 missense probably benign 0.06
X0066:Lama1 UTSW 17 67811566 missense probably damaging 1.00
Z1088:Lama1 UTSW 17 67752883 missense probably benign 0.00
Z1088:Lama1 UTSW 17 67771082 missense probably benign 0.25
Z1088:Lama1 UTSW 17 67810171 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGATGGGTACGGAACTTAATTAC -3'
(R):5'- ATTGCAATACGCCCAGCTCC -3'

Sequencing Primer
(F):5'- CGGGGCATTAAATTGAATTACAAGTG -3'
(R):5'- CATAACTGTATCCCTTGTTTGAACAG -3'
Posted On2019-12-04