Incidental Mutation 'RF002:Mapkapk2'
ID 602538
Institutional Source Beutler Lab
Gene Symbol Mapkapk2
Ensembl Gene ENSMUSG00000016528
Gene Name MAP kinase-activated protein kinase 2
Synonyms MAPKAP kinase 2, Rps6kc1, MK2
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 130981437-131025563 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 130984250 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 251 (S251P)
Ref Sequence ENSEMBL: ENSMUSP00000016672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016672] [ENSMUST00000188459]
AlphaFold P49138
Predicted Effect probably damaging
Transcript: ENSMUST00000016672
AA Change: S251P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016672
Gene: ENSMUSG00000016528
AA Change: S251P

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
S_TKc 50 311 1.26e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188459
SMART Domains Protein: ENSMUSP00000141124
Gene: ENSMUSG00000016528

DomainStartEndE-ValueType
S_TKc 1 160 4.5e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ser/Thr protein kinase family. This kinase is regulated through direct phosphorylation by p38 MAP kinase. In conjunction with p38 MAP kinase, this kinase is known to be involved in many cellular processes including stress and inflammatory responses, nuclear export, gene expression regulation and cell proliferation. Heat shock protein HSP27 was shown to be one of the substrates of this kinase in vivo. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inactivation of this locus affects the inflammatory response. Homozygous null mice show an increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
AI837181 GGC GGCTGC 19: 5,475,263 (GRCm39) probably benign Het
Angptl1 A T 1: 156,684,794 (GRCm39) Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 52,043,050 (GRCm39) probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,162,653 (GRCm39) probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,162,675 (GRCm39) probably benign Het
Car13 T C 3: 14,719,974 (GRCm39) Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,619,805 (GRCm39) probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,619,810 (GRCm39) probably benign Het
Cdh26 T C 2: 178,108,424 (GRCm39) C341R probably damaging Het
Chga GCA GCACCA 12: 102,527,680 (GRCm39) probably benign Het
Col11a1 A T 3: 114,010,650 (GRCm39) I1689L unknown Het
Dnah6 T G 6: 73,078,872 (GRCm39) S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,674,160 (GRCm39) probably benign Het
Fah A C 7: 84,238,836 (GRCm39) N336K probably damaging Het
Fbxo11 A T 17: 88,303,481 (GRCm39) I664K Het
Fcgbp A G 7: 27,789,180 (GRCm39) D582G probably benign Het
Gabre C CCGGCTA X: 71,313,663 (GRCm39) probably null Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm1110 A G 9: 26,831,936 (GRCm39) Y72H probably damaging Het
Inpp5e C T 2: 26,298,389 (GRCm39) A71T possibly damaging Het
Iqcm C T 8: 76,304,527 (GRCm39) T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 92,925,590 (GRCm39) probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 92,925,606 (GRCm39) probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 75,185,014 (GRCm39) probably benign Het
Lyst A G 13: 13,808,948 (GRCm39) D206G probably benign Het
Map4k5 A T 12: 69,903,630 (GRCm39) D58E probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,702,545 (GRCm39) probably benign Het
Men1 T C 19: 6,390,146 (GRCm39) S600P probably damaging Het
Mllt1 C T 17: 57,203,300 (GRCm39) V394M probably benign Het
Mllt1 C A 17: 57,203,301 (GRCm39) M393I possibly damaging Het
Nacc1 T C 8: 85,402,848 (GRCm39) E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,891,047 (GRCm39) probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,050 (GRCm39) probably benign Het
Nid2 TAACACCGCCA TA 14: 19,801,434 (GRCm39) probably benign Het
Or5b122 T A 19: 13,563,415 (GRCm39) I206N probably damaging Het
Parp2 A G 14: 51,054,843 (GRCm39) E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,006,686 (GRCm39) probably null Het
Pop1 G A 15: 34,502,583 (GRCm39) G90D probably damaging Het
Ppp3cc T C 14: 70,504,788 (GRCm39) T73A possibly damaging Het
Prdm15 C T 16: 97,600,829 (GRCm39) D810N probably damaging Het
Prpf4b T A 13: 35,068,219 (GRCm39) S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,756,780 (GRCm39) probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,756,784 (GRCm39) probably null Het
Sdk2 T C 11: 113,776,078 (GRCm39) E208G probably benign Het
Smurf2 G T 11: 106,743,413 (GRCm39) P211Q probably benign Het
Snx25 C A 8: 46,569,218 (GRCm39) probably null Het
Spata6 T A 4: 111,685,502 (GRCm39) M469K probably benign Het
Spta1 G T 1: 174,058,926 (GRCm39) A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 (GRCm39) probably benign Het
Stard8 GAG GAGTAG X: 98,110,121 (GRCm39) probably null Het
Tfeb AGC AGCGGC 17: 48,097,027 (GRCm39) probably benign Het
Tlcd1 T A 11: 78,071,020 (GRCm39) L203Q probably benign Het
Tlr11 T C 14: 50,598,682 (GRCm39) F223L possibly damaging Het
Usp48 T A 4: 137,333,106 (GRCm39) V100D probably damaging Het
Vinac1 A G 2: 128,880,714 (GRCm39) F404S Het
Vmn2r56 G A 7: 12,428,757 (GRCm39) T503I probably benign Het
Vps18 T C 2: 119,127,871 (GRCm39) L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp706 T A 15: 37,003,949 (GRCm39) Y39F probably benign Het
Zhx3 T A 2: 160,623,726 (GRCm39) N147I probably damaging Het
Other mutations in Mapkapk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:Mapkapk2 APN 1 130,986,499 (GRCm39) start codon destroyed probably null
R0015:Mapkapk2 UTSW 1 131,025,063 (GRCm39) missense possibly damaging 0.79
R0318:Mapkapk2 UTSW 1 131,025,072 (GRCm39) missense probably damaging 0.99
R1234:Mapkapk2 UTSW 1 130,983,513 (GRCm39) nonsense probably null
R1755:Mapkapk2 UTSW 1 130,986,087 (GRCm39) critical splice donor site probably null
R1765:Mapkapk2 UTSW 1 130,986,498 (GRCm39) start codon destroyed probably null 0.09
R3907:Mapkapk2 UTSW 1 130,984,651 (GRCm39) missense probably damaging 1.00
R5949:Mapkapk2 UTSW 1 130,985,742 (GRCm39) missense possibly damaging 0.95
R6838:Mapkapk2 UTSW 1 130,985,740 (GRCm39) nonsense probably null
R7445:Mapkapk2 UTSW 1 131,025,256 (GRCm39) missense unknown
R7802:Mapkapk2 UTSW 1 130,984,639 (GRCm39) missense possibly damaging 0.51
R7839:Mapkapk2 UTSW 1 131,025,256 (GRCm39) missense unknown
R8710:Mapkapk2 UTSW 1 130,986,448 (GRCm39) missense possibly damaging 0.81
R8773:Mapkapk2 UTSW 1 130,983,679 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGATACCTACACGTGCGTAC -3'
(R):5'- GAGTTCCTGCTTCACTTGATGC -3'

Sequencing Primer
(F):5'- GTACGCTCGCACACACTC -3'
(R):5'- AGCTAATGGGCTAGCCGTCTAG -3'
Posted On 2019-12-04