Incidental Mutation 'RF002:Mapkapk2'
ID 602538
Institutional Source Beutler Lab
Gene Symbol Mapkapk2
Ensembl Gene ENSMUSG00000016528
Gene Name MAP kinase-activated protein kinase 2
Synonyms MAPKAP kinase 2, Rps6kc1, MK2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 131053700-131097826 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 131056513 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 251 (S251P)
Ref Sequence ENSEMBL: ENSMUSP00000016672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016672] [ENSMUST00000188459]
AlphaFold P49138
Predicted Effect probably damaging
Transcript: ENSMUST00000016672
AA Change: S251P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016672
Gene: ENSMUSG00000016528
AA Change: S251P

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
S_TKc 50 311 1.26e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188459
SMART Domains Protein: ENSMUSP00000141124
Gene: ENSMUSG00000016528

DomainStartEndE-ValueType
S_TKc 1 160 4.5e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ser/Thr protein kinase family. This kinase is regulated through direct phosphorylation by p38 MAP kinase. In conjunction with p38 MAP kinase, this kinase is known to be involved in many cellular processes including stress and inflammatory responses, nuclear export, gene expression regulation and cell proliferation. Heat shock protein HSP27 was shown to be one of the substrates of this kinase in vivo. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inactivation of this locus affects the inflammatory response. Homozygous null mice show an increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,941,047 probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,050 probably benign Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,608,925 probably null Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 probably benign Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Mapkapk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:Mapkapk2 APN 1 131058762 start codon destroyed probably null
R0015:Mapkapk2 UTSW 1 131097326 missense possibly damaging 0.79
R0318:Mapkapk2 UTSW 1 131097335 missense probably damaging 0.99
R1234:Mapkapk2 UTSW 1 131055776 nonsense probably null
R1755:Mapkapk2 UTSW 1 131058350 critical splice donor site probably null
R1765:Mapkapk2 UTSW 1 131058761 start codon destroyed probably null 0.09
R3907:Mapkapk2 UTSW 1 131056914 missense probably damaging 1.00
R5949:Mapkapk2 UTSW 1 131058005 missense possibly damaging 0.95
R6838:Mapkapk2 UTSW 1 131058003 nonsense probably null
R7445:Mapkapk2 UTSW 1 131097519 missense unknown
R7802:Mapkapk2 UTSW 1 131056902 missense possibly damaging 0.51
R7839:Mapkapk2 UTSW 1 131097519 missense unknown
R8710:Mapkapk2 UTSW 1 131058711 missense possibly damaging 0.81
R8773:Mapkapk2 UTSW 1 131055942 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGATACCTACACGTGCGTAC -3'
(R):5'- GAGTTCCTGCTTCACTTGATGC -3'

Sequencing Primer
(F):5'- GTACGCTCGCACACACTC -3'
(R):5'- AGCTAATGGGCTAGCCGTCTAG -3'
Posted On 2019-12-04