Incidental Mutation 'RF002:Inpp5e'
ID 602541
Institutional Source Beutler Lab
Gene Symbol Inpp5e
Ensembl Gene ENSMUSG00000026925
Gene Name inositol polyphosphate-5-phosphatase E
Synonyms 1200002L24Rik, 72kDa
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 26286261-26299215 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 26298389 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 71 (A71T)
Ref Sequence ENSEMBL: ENSMUSP00000119485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082] [ENSMUST00000114090] [ENSMUST00000145701]
AlphaFold Q9JII1
Predicted Effect probably benign
Transcript: ENSMUST00000091252
SMART Domains Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1463 1565 3.1e-24 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1635 1898 2.3e-39 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114082
SMART Domains Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1464 1564 2.6e-10 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1636 1887 6.8e-45 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
low complexity region 2310 2320 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114090
AA Change: A71T

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109724
Gene: ENSMUSG00000026925
AA Change: A71T

DomainStartEndE-ValueType
low complexity region 277 294 N/A INTRINSIC
IPPc 300 602 1.27e-62 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000145701
AA Change: A71T

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119485
Gene: ENSMUSG00000026925
AA Change: A71T

DomainStartEndE-ValueType
low complexity region 277 294 N/A INTRINSIC
IPPc 300 602 1.27e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156442
SMART Domains Protein: ENSMUSP00000122255
Gene: ENSMUSG00000026924

DomainStartEndE-ValueType
Pfam:Sec16 14 114 7.7e-11 PFAM
low complexity region 150 164 N/A INTRINSIC
Pfam:Sec16_C 186 438 1.6e-45 PFAM
low complexity region 659 674 N/A INTRINSIC
low complexity region 715 727 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 777 792 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase. InsP3 5-phosphatases hydrolyze Ins(1,4,5)P3, which mobilizes intracellular calcium and acts as a second messenger mediating cell responses to various stimulation. Studies of the mouse counterpart suggest that this protein may hydrolyze phosphatidylinositol 3,4,5-trisphosphate and phosphatidylinositol 3,5-bisphosphate on the cytoplasmic Golgi membrane and thereby regulate Golgi-vesicular trafficking. Mutations in this gene cause Joubert syndrome; a clinically and genetically heterogenous group of disorders characterized by midbrain-hindbrain malformation and various associated ciliopathies that include retinal dystrophy, nephronophthisis, liver fibrosis and polydactyly. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null mutation display signs of ciliopathies including prenatal and perinatal lethality, polycystic kidneys, arrest of eye development, abnormalities in primary cilia, cerebral developmental defects, and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
AI837181 GGC GGCTGC 19: 5,475,263 (GRCm39) probably benign Het
Angptl1 A T 1: 156,684,794 (GRCm39) Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 52,043,050 (GRCm39) probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,162,653 (GRCm39) probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,162,675 (GRCm39) probably benign Het
Car13 T C 3: 14,719,974 (GRCm39) Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,619,805 (GRCm39) probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,619,810 (GRCm39) probably benign Het
Cdh26 T C 2: 178,108,424 (GRCm39) C341R probably damaging Het
Chga GCA GCACCA 12: 102,527,680 (GRCm39) probably benign Het
Col11a1 A T 3: 114,010,650 (GRCm39) I1689L unknown Het
Dnah6 T G 6: 73,078,872 (GRCm39) S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,674,160 (GRCm39) probably benign Het
Fah A C 7: 84,238,836 (GRCm39) N336K probably damaging Het
Fbxo11 A T 17: 88,303,481 (GRCm39) I664K Het
Fcgbp A G 7: 27,789,180 (GRCm39) D582G probably benign Het
Gabre C CCGGCTA X: 71,313,663 (GRCm39) probably null Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm1110 A G 9: 26,831,936 (GRCm39) Y72H probably damaging Het
Iqcm C T 8: 76,304,527 (GRCm39) T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 92,925,590 (GRCm39) probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 92,925,606 (GRCm39) probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 75,185,014 (GRCm39) probably benign Het
Lyst A G 13: 13,808,948 (GRCm39) D206G probably benign Het
Map4k5 A T 12: 69,903,630 (GRCm39) D58E probably damaging Het
Mapkapk2 A G 1: 130,984,250 (GRCm39) S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,702,545 (GRCm39) probably benign Het
Men1 T C 19: 6,390,146 (GRCm39) S600P probably damaging Het
Mllt1 C T 17: 57,203,300 (GRCm39) V394M probably benign Het
Mllt1 C A 17: 57,203,301 (GRCm39) M393I possibly damaging Het
Nacc1 T C 8: 85,402,848 (GRCm39) E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,891,047 (GRCm39) probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,050 (GRCm39) probably benign Het
Nid2 TAACACCGCCA TA 14: 19,801,434 (GRCm39) probably benign Het
Or5b122 T A 19: 13,563,415 (GRCm39) I206N probably damaging Het
Parp2 A G 14: 51,054,843 (GRCm39) E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,006,686 (GRCm39) probably null Het
Pop1 G A 15: 34,502,583 (GRCm39) G90D probably damaging Het
Ppp3cc T C 14: 70,504,788 (GRCm39) T73A possibly damaging Het
Prdm15 C T 16: 97,600,829 (GRCm39) D810N probably damaging Het
Prpf4b T A 13: 35,068,219 (GRCm39) S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,756,780 (GRCm39) probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,756,784 (GRCm39) probably null Het
Sdk2 T C 11: 113,776,078 (GRCm39) E208G probably benign Het
Smurf2 G T 11: 106,743,413 (GRCm39) P211Q probably benign Het
Snx25 C A 8: 46,569,218 (GRCm39) probably null Het
Spata6 T A 4: 111,685,502 (GRCm39) M469K probably benign Het
Spta1 G T 1: 174,058,926 (GRCm39) A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 (GRCm39) probably benign Het
Stard8 GAG GAGTAG X: 98,110,121 (GRCm39) probably null Het
Tfeb AGC AGCGGC 17: 48,097,027 (GRCm39) probably benign Het
Tlcd1 T A 11: 78,071,020 (GRCm39) L203Q probably benign Het
Tlr11 T C 14: 50,598,682 (GRCm39) F223L possibly damaging Het
Usp48 T A 4: 137,333,106 (GRCm39) V100D probably damaging Het
Vinac1 A G 2: 128,880,714 (GRCm39) F404S Het
Vmn2r56 G A 7: 12,428,757 (GRCm39) T503I probably benign Het
Vps18 T C 2: 119,127,871 (GRCm39) L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp706 T A 15: 37,003,949 (GRCm39) Y39F probably benign Het
Zhx3 T A 2: 160,623,726 (GRCm39) N147I probably damaging Het
Other mutations in Inpp5e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Inpp5e APN 2 26,298,533 (GRCm39) missense probably benign
IGL00943:Inpp5e APN 2 26,290,163 (GRCm39) splice site probably benign
IGL01518:Inpp5e APN 2 26,287,946 (GRCm39) missense probably damaging 1.00
R0212:Inpp5e UTSW 2 26,298,352 (GRCm39) splice site probably null
R1818:Inpp5e UTSW 2 26,287,886 (GRCm39) missense probably benign 0.00
R1876:Inpp5e UTSW 2 26,298,169 (GRCm39) missense possibly damaging 0.91
R2508:Inpp5e UTSW 2 26,289,355 (GRCm39) missense probably damaging 1.00
R4175:Inpp5e UTSW 2 26,290,937 (GRCm39) missense probably damaging 0.99
R4647:Inpp5e UTSW 2 26,297,926 (GRCm39) missense probably benign 0.01
R4668:Inpp5e UTSW 2 26,291,006 (GRCm39) missense probably damaging 0.97
R4895:Inpp5e UTSW 2 26,287,924 (GRCm39) missense probably damaging 1.00
R4908:Inpp5e UTSW 2 26,290,918 (GRCm39) missense probably damaging 1.00
R5090:Inpp5e UTSW 2 26,289,383 (GRCm39) splice site probably null
R5096:Inpp5e UTSW 2 26,289,537 (GRCm39) missense probably damaging 1.00
R5830:Inpp5e UTSW 2 26,290,427 (GRCm39) missense probably damaging 1.00
R6056:Inpp5e UTSW 2 26,297,860 (GRCm39) nonsense probably null
R6899:Inpp5e UTSW 2 26,290,060 (GRCm39) missense possibly damaging 0.77
R6939:Inpp5e UTSW 2 26,297,774 (GRCm39) splice site probably null
R7003:Inpp5e UTSW 2 26,287,877 (GRCm39) missense probably benign 0.01
R7164:Inpp5e UTSW 2 26,297,995 (GRCm39) missense possibly damaging 0.66
R7275:Inpp5e UTSW 2 26,298,104 (GRCm39) missense probably benign 0.00
R7285:Inpp5e UTSW 2 26,287,870 (GRCm39) missense probably benign 0.36
R7468:Inpp5e UTSW 2 26,298,161 (GRCm39) missense probably benign 0.00
R7873:Inpp5e UTSW 2 26,297,957 (GRCm39) nonsense probably null
R8032:Inpp5e UTSW 2 26,286,865 (GRCm39) missense
R8146:Inpp5e UTSW 2 26,289,274 (GRCm39) missense probably benign 0.00
R9227:Inpp5e UTSW 2 26,288,616 (GRCm39) missense probably damaging 1.00
R9310:Inpp5e UTSW 2 26,287,940 (GRCm39) missense probably benign
R9706:Inpp5e UTSW 2 26,292,126 (GRCm39) missense probably benign 0.21
X0061:Inpp5e UTSW 2 26,292,159 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTGCAAGGATGTGCTGAG -3'
(R):5'- CTGGACTATGCCATCCAAGTCAG -3'

Sequencing Primer
(F):5'- GACGGCTGTAGGCAGGG -3'
(R):5'- TTGCCTGCGTCACACTGAG -3'
Posted On 2019-12-04