Incidental Mutation 'RF002:Gm14025'
ID 602543
Institutional Source Beutler Lab
Gene Symbol Gm14025
Ensembl Gene ENSMUSG00000079051
Gene Name predicted gene 14025
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # RF002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 129025073-129048172 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129038794 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 404 (F404S)
Ref Sequence ENSEMBL: ENSMUSP00000123404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145798]
AlphaFold A2AP89
Predicted Effect
SMART Domains Protein: ENSMUSP00000123404
Gene: ENSMUSG00000079051
AA Change: F404S

DomainStartEndE-ValueType
Pfam:Vinculin 14 248 5.8e-18 PFAM
Pfam:Vinculin 281 619 2.1e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,941,047 probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,050 probably benign Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,608,925 probably null Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 probably benign Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Gm14025
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Gm14025 APN 2 129038702 missense probably benign 0.01
IGL02423:Gm14025 APN 2 129048048 missense probably benign 0.03
IGL02730:Gm14025 APN 2 129038726 missense possibly damaging 0.57
PIT4677001:Gm14025 UTSW 2 129038716 missense
R0019:Gm14025 UTSW 2 129039026 missense probably benign 0.26
R3946:Gm14025 UTSW 2 129039601 missense probably damaging 1.00
R4666:Gm14025 UTSW 2 129038230 missense probably benign 0.02
R4819:Gm14025 UTSW 2 129040801 missense probably damaging 0.96
R5634:Gm14025 UTSW 2 129039486 missense probably benign
R6019:Gm14025 UTSW 2 129037690 missense probably benign
R6241:Gm14025 UTSW 2 129037381 missense possibly damaging 0.87
R6285:Gm14025 UTSW 2 129037799 missense possibly damaging 0.82
R6377:Gm14025 UTSW 2 129036811 missense unknown
R6464:Gm14025 UTSW 2 129039545 missense possibly damaging 0.85
R6724:Gm14025 UTSW 2 129038056 missense probably benign 0.23
R7050:Gm14025 UTSW 2 129027971 splice site probably null
R7130:Gm14025 UTSW 2 129039181 missense
R7199:Gm14025 UTSW 2 129038318 missense
R7324:Gm14025 UTSW 2 129037852 missense unknown
R7355:Gm14025 UTSW 2 129037229 missense unknown
R7407:Gm14025 UTSW 2 129038809 missense
R7634:Gm14025 UTSW 2 129038272 missense
R7688:Gm14025 UTSW 2 129039044 nonsense probably null
R7889:Gm14025 UTSW 2 129036994 missense unknown
R7894:Gm14025 UTSW 2 129037129 missense unknown
R8242:Gm14025 UTSW 2 129039393 nonsense probably null
R8373:Gm14025 UTSW 2 129038171 missense
R8927:Gm14025 UTSW 2 129040869 missense
R8928:Gm14025 UTSW 2 129040869 missense
R9231:Gm14025 UTSW 2 129037420 missense unknown
X0066:Gm14025 UTSW 2 129039067 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CAAAGCATGACAGGAGGTGTTC -3'
(R):5'- GACTGATGCGCTCTTTCGAG -3'

Sequencing Primer
(F):5'- ACAGGAGGTGTTCGGATTCCC -3'
(R):5'- GCAGTTCGCGCTGGGTTAC -3'
Posted On 2019-12-04