Incidental Mutation 'RF002:Zhx3'
ID 602544
Institutional Source Beutler Lab
Gene Symbol Zhx3
Ensembl Gene ENSMUSG00000035877
Gene Name zinc fingers and homeoboxes 3
Synonyms Tix1, 1810059C13Rik, 9530010N21Rik, 4932418O04Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 160612367-160714910 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 160623726 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 147 (N147I)
Ref Sequence ENSEMBL: ENSMUSP00000099400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103111] [ENSMUST00000103112] [ENSMUST00000109460] [ENSMUST00000127201] [ENSMUST00000176141]
AlphaFold Q8C0Q2
Predicted Effect probably damaging
Transcript: ENSMUST00000103111
AA Change: N147I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099400
Gene: ENSMUSG00000035877
AA Change: N147I

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 836 888 5.2e-26 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103112
AA Change: N147I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099401
Gene: ENSMUSG00000035877
AA Change: N147I

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 836 888 5.2e-26 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109460
AA Change: N147I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105086
Gene: ENSMUSG00000035877
AA Change: N147I

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 841 888 1.3e-17 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127201
SMART Domains Protein: ENSMUSP00000120488
Gene: ENSMUSG00000035877

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176141
SMART Domains Protein: ENSMUSP00000134763
Gene: ENSMUSG00000035877

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc fingers and homeoboxes (ZHX) gene family. The encoded protein contains two C2H2-type zinc fingers and five homeodomains and forms a dimer with itself or with zinc fingers and homeoboxes family member 1. In the nucleus, the dimerized protein interacts with the A subunit of the ubiquitous transcription factor nuclear factor-Y and may function as a transcriptional repressor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
AI837181 GGC GGCTGC 19: 5,475,263 (GRCm39) probably benign Het
Angptl1 A T 1: 156,684,794 (GRCm39) Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 52,043,050 (GRCm39) probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,162,653 (GRCm39) probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,162,675 (GRCm39) probably benign Het
Car13 T C 3: 14,719,974 (GRCm39) Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,619,805 (GRCm39) probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,619,810 (GRCm39) probably benign Het
Cdh26 T C 2: 178,108,424 (GRCm39) C341R probably damaging Het
Chga GCA GCACCA 12: 102,527,680 (GRCm39) probably benign Het
Col11a1 A T 3: 114,010,650 (GRCm39) I1689L unknown Het
Dnah6 T G 6: 73,078,872 (GRCm39) S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,674,160 (GRCm39) probably benign Het
Fah A C 7: 84,238,836 (GRCm39) N336K probably damaging Het
Fbxo11 A T 17: 88,303,481 (GRCm39) I664K Het
Fcgbp A G 7: 27,789,180 (GRCm39) D582G probably benign Het
Gabre C CCGGCTA X: 71,313,663 (GRCm39) probably null Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm1110 A G 9: 26,831,936 (GRCm39) Y72H probably damaging Het
Inpp5e C T 2: 26,298,389 (GRCm39) A71T possibly damaging Het
Iqcm C T 8: 76,304,527 (GRCm39) T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 92,925,590 (GRCm39) probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 92,925,606 (GRCm39) probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 75,185,014 (GRCm39) probably benign Het
Lyst A G 13: 13,808,948 (GRCm39) D206G probably benign Het
Map4k5 A T 12: 69,903,630 (GRCm39) D58E probably damaging Het
Mapkapk2 A G 1: 130,984,250 (GRCm39) S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,702,545 (GRCm39) probably benign Het
Men1 T C 19: 6,390,146 (GRCm39) S600P probably damaging Het
Mllt1 C T 17: 57,203,300 (GRCm39) V394M probably benign Het
Mllt1 C A 17: 57,203,301 (GRCm39) M393I possibly damaging Het
Nacc1 T C 8: 85,402,848 (GRCm39) E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,891,047 (GRCm39) probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,050 (GRCm39) probably benign Het
Nid2 TAACACCGCCA TA 14: 19,801,434 (GRCm39) probably benign Het
Or5b122 T A 19: 13,563,415 (GRCm39) I206N probably damaging Het
Parp2 A G 14: 51,054,843 (GRCm39) E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,006,686 (GRCm39) probably null Het
Pop1 G A 15: 34,502,583 (GRCm39) G90D probably damaging Het
Ppp3cc T C 14: 70,504,788 (GRCm39) T73A possibly damaging Het
Prdm15 C T 16: 97,600,829 (GRCm39) D810N probably damaging Het
Prpf4b T A 13: 35,068,219 (GRCm39) S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,756,780 (GRCm39) probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,756,784 (GRCm39) probably null Het
Sdk2 T C 11: 113,776,078 (GRCm39) E208G probably benign Het
Smurf2 G T 11: 106,743,413 (GRCm39) P211Q probably benign Het
Snx25 C A 8: 46,569,218 (GRCm39) probably null Het
Spata6 T A 4: 111,685,502 (GRCm39) M469K probably benign Het
Spta1 G T 1: 174,058,926 (GRCm39) A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 (GRCm39) probably benign Het
Stard8 GAG GAGTAG X: 98,110,121 (GRCm39) probably null Het
Tfeb AGC AGCGGC 17: 48,097,027 (GRCm39) probably benign Het
Tlcd1 T A 11: 78,071,020 (GRCm39) L203Q probably benign Het
Tlr11 T C 14: 50,598,682 (GRCm39) F223L possibly damaging Het
Usp48 T A 4: 137,333,106 (GRCm39) V100D probably damaging Het
Vinac1 A G 2: 128,880,714 (GRCm39) F404S Het
Vmn2r56 G A 7: 12,428,757 (GRCm39) T503I probably benign Het
Vps18 T C 2: 119,127,871 (GRCm39) L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp706 T A 15: 37,003,949 (GRCm39) Y39F probably benign Het
Other mutations in Zhx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Zhx3 APN 2 160,622,761 (GRCm39) missense probably damaging 0.99
IGL01759:Zhx3 APN 2 160,622,634 (GRCm39) missense probably damaging 1.00
IGL02170:Zhx3 APN 2 160,621,718 (GRCm39) missense probably damaging 1.00
IGL02550:Zhx3 APN 2 160,623,216 (GRCm39) missense probably damaging 1.00
R0497:Zhx3 UTSW 2 160,621,914 (GRCm39) nonsense probably null
R0882:Zhx3 UTSW 2 160,622,629 (GRCm39) missense probably damaging 1.00
R1396:Zhx3 UTSW 2 160,622,940 (GRCm39) missense possibly damaging 0.90
R1587:Zhx3 UTSW 2 160,623,613 (GRCm39) splice site probably null
R1646:Zhx3 UTSW 2 160,623,195 (GRCm39) missense probably damaging 1.00
R1822:Zhx3 UTSW 2 160,622,275 (GRCm39) missense probably benign 0.03
R2322:Zhx3 UTSW 2 160,623,948 (GRCm39) missense probably damaging 1.00
R3791:Zhx3 UTSW 2 160,622,368 (GRCm39) missense possibly damaging 0.94
R3899:Zhx3 UTSW 2 160,622,371 (GRCm39) missense possibly damaging 0.82
R4003:Zhx3 UTSW 2 160,622,809 (GRCm39) missense probably damaging 0.96
R4619:Zhx3 UTSW 2 160,623,879 (GRCm39) missense probably damaging 0.96
R5307:Zhx3 UTSW 2 160,621,788 (GRCm39) missense probably benign 0.02
R5461:Zhx3 UTSW 2 160,621,938 (GRCm39) missense probably benign
R5648:Zhx3 UTSW 2 160,623,881 (GRCm39) missense probably damaging 1.00
R5952:Zhx3 UTSW 2 160,623,937 (GRCm39) missense probably damaging 1.00
R6035:Zhx3 UTSW 2 160,621,463 (GRCm39) missense probably benign
R6035:Zhx3 UTSW 2 160,621,463 (GRCm39) missense probably benign
R6734:Zhx3 UTSW 2 160,623,640 (GRCm39) missense probably damaging 0.99
R6988:Zhx3 UTSW 2 160,621,788 (GRCm39) missense probably benign 0.02
R7032:Zhx3 UTSW 2 160,622,898 (GRCm39) missense probably damaging 1.00
R7288:Zhx3 UTSW 2 160,623,042 (GRCm39) missense probably damaging 1.00
R7348:Zhx3 UTSW 2 160,624,038 (GRCm39) nonsense probably null
R7947:Zhx3 UTSW 2 160,623,015 (GRCm39) missense probably damaging 1.00
R8101:Zhx3 UTSW 2 160,623,619 (GRCm39) missense probably damaging 0.99
R8152:Zhx3 UTSW 2 160,622,695 (GRCm39) missense probably benign
R8831:Zhx3 UTSW 2 160,622,691 (GRCm39) missense probably benign 0.05
R8886:Zhx3 UTSW 2 160,623,216 (GRCm39) missense probably damaging 1.00
R9310:Zhx3 UTSW 2 160,621,393 (GRCm39) missense possibly damaging 0.94
R9363:Zhx3 UTSW 2 160,621,785 (GRCm39) missense probably benign 0.00
R9422:Zhx3 UTSW 2 160,624,020 (GRCm39) missense probably benign 0.00
R9687:Zhx3 UTSW 2 160,623,678 (GRCm39) missense probably benign 0.01
Z1088:Zhx3 UTSW 2 160,621,675 (GRCm39) unclassified probably benign
Z1176:Zhx3 UTSW 2 160,622,980 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGATGAAAGTGTGGTCCCC -3'
(R):5'- TTCAGGTCCCAGGATGTGAC -3'

Sequencing Primer
(F):5'- TCACTCCCAGGCTGATTAGGAG -3'
(R):5'- CCAGGATGTGACCCACTTTATAGG -3'
Posted On 2019-12-04