Incidental Mutation 'RF002:Pdik1l'
ID 602551
Institutional Source Beutler Lab
Gene Symbol Pdik1l
Ensembl Gene ENSMUSG00000050890
Gene Name PDLIM1 interacting kinase 1 like
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF002 (G1)
Quality Score 214.458
Status Not validated
Chromosome 4
Chromosomal Location 134275002-134287895 bp(-) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) TTT to TTTGTTTTTGTGTT at 134279375 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061234] [ENSMUST00000105876] [ENSMUST00000105877] [ENSMUST00000127857] [ENSMUST00000145006]
AlphaFold Q8QZR7
Predicted Effect probably benign
Transcript: ENSMUST00000061234
SMART Domains Protein: ENSMUSP00000060381
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 8 106 3e-8 PFAM
Pfam:Pkinase 8 328 2.2e-52 PFAM
Pfam:Pkinase_Tyr 99 329 5.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105876
SMART Domains Protein: ENSMUSP00000101502
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 8 106 3e-8 PFAM
Pfam:Pkinase 8 328 2.2e-52 PFAM
Pfam:Pkinase_Tyr 99 329 5.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105877
SMART Domains Protein: ENSMUSP00000101503
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 84 184 2.2e-7 PFAM
Pfam:Pkinase 84 402 4.5e-51 PFAM
Pfam:Pkinase_Tyr 185 405 6.3e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000127857
SMART Domains Protein: ENSMUSP00000117719
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase 8 113 3.4e-12 PFAM
Pfam:Pkinase_Tyr 8 136 8.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145006
SMART Domains Protein: ENSMUSP00000118116
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 8 185 4.1e-24 PFAM
Pfam:Pkinase 10 187 4.9e-38 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,941,047 probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,050 probably benign Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,608,925 probably null Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 probably benign Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Pdik1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02439:Pdik1l APN 4 134278704 missense probably benign 0.11
FR4304:Pdik1l UTSW 4 134279374 frame shift probably null
FR4340:Pdik1l UTSW 4 134279512 intron probably benign
FR4342:Pdik1l UTSW 4 134279509 intron probably benign
FR4548:Pdik1l UTSW 4 134279512 intron probably benign
FR4589:Pdik1l UTSW 4 134279368 frame shift probably null
FR4589:Pdik1l UTSW 4 134279369 frame shift probably null
FR4737:Pdik1l UTSW 4 134279367 frame shift probably null
FR4737:Pdik1l UTSW 4 134279506 intron probably benign
FR4976:Pdik1l UTSW 4 134279506 intron probably benign
R1867:Pdik1l UTSW 4 134278911 missense probably damaging 1.00
R2106:Pdik1l UTSW 4 134284254 missense probably damaging 1.00
R2303:Pdik1l UTSW 4 134284248 nonsense probably null
R2398:Pdik1l UTSW 4 134278399 missense probably benign 0.01
R3162:Pdik1l UTSW 4 134284250 missense probably damaging 1.00
R3162:Pdik1l UTSW 4 134284250 missense probably damaging 1.00
R4515:Pdik1l UTSW 4 134278896 missense probably damaging 1.00
R4711:Pdik1l UTSW 4 134278990 missense probably benign 0.15
R5602:Pdik1l UTSW 4 134284269 missense probably damaging 0.99
R5822:Pdik1l UTSW 4 134287163 missense possibly damaging 0.53
R6031:Pdik1l UTSW 4 134279041 missense probably damaging 0.98
R6031:Pdik1l UTSW 4 134279041 missense probably damaging 0.98
R7517:Pdik1l UTSW 4 134278425 missense possibly damaging 0.83
R7705:Pdik1l UTSW 4 134279493 missense unknown
R8203:Pdik1l UTSW 4 134279365 missense unknown
R8524:Pdik1l UTSW 4 134286610 missense probably benign
RF007:Pdik1l UTSW 4 134279368 frame shift probably null
RF008:Pdik1l UTSW 4 134279511 intron probably benign
RF022:Pdik1l UTSW 4 134279367 frame shift probably null
RF025:Pdik1l UTSW 4 134286594 frame shift probably null
RF026:Pdik1l UTSW 4 134286594 intron probably benign
RF030:Pdik1l UTSW 4 134279516 intron probably benign
RF031:Pdik1l UTSW 4 134279374 frame shift probably null
RF034:Pdik1l UTSW 4 134279374 frame shift probably null
RF035:Pdik1l UTSW 4 134279510 intron probably benign
RF040:Pdik1l UTSW 4 134279515 intron probably benign
RF048:Pdik1l UTSW 4 134279372 frame shift probably null
RF056:Pdik1l UTSW 4 134279502 intron probably benign
RF056:Pdik1l UTSW 4 134279516 intron probably benign
RF057:Pdik1l UTSW 4 134279368 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTACAAGCTGTGAAGGATGGG -3'
(R):5'- GCAGATTGACCTAACGTTTTCC -3'

Sequencing Primer
(F):5'- CTGAATTTACTGCTCTCACAGAGGAC -3'
(R):5'- GATTGACCTAACGTTTTCCTTCTTTC -3'
Posted On 2019-12-04