Incidental Mutation 'RF002:Zfp384'
ID 602556
Institutional Source Beutler Lab
Gene Symbol Zfp384
Ensembl Gene ENSMUSG00000038346
Gene Name zinc finger protein 384
Synonyms Ciz, C130073D16Rik, Nmp4
Accession Numbers
Essential gene? Probably non essential (E-score: 0.169) question?
Stock # RF002 (G1)
Quality Score 217.468
Status Not validated
Chromosome 6
Chromosomal Location 124986108-125014833 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) GCCCAGGCCCAGGCCCAGGCCCAG to GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG at 125013434 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032480] [ENSMUST00000046064] [ENSMUST00000054553] [ENSMUST00000084275] [ENSMUST00000088308] [ENSMUST00000112417] [ENSMUST00000112424] [ENSMUST00000112425] [ENSMUST00000112427] [ENSMUST00000112428] [ENSMUST00000140131]
AlphaFold E9Q1A5
Predicted Effect probably benign
Transcript: ENSMUST00000032480
SMART Domains Protein: ENSMUSP00000032480
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 5.5e-35 PFAM
low complexity region 118 131 N/A INTRINSIC
PHD 197 242 3.67e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046064
SMART Domains Protein: ENSMUSP00000037986
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 260 282 3.47e0 SMART
ZnF_C2H2 288 310 2.99e-4 SMART
ZnF_C2H2 316 338 1.95e-3 SMART
ZnF_C2H2 344 368 7.37e-4 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 404 426 3.44e-4 SMART
low complexity region 432 490 N/A INTRINSIC
low complexity region 491 496 N/A INTRINSIC
low complexity region 499 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054553
SMART Domains Protein: ENSMUSP00000086354
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 133 144 N/A INTRINSIC
ZnF_C2H2 174 196 7.26e-3 SMART
ZnF_C2H2 202 224 2.99e-4 SMART
ZnF_C2H2 230 252 1.95e-3 SMART
ZnF_C2H2 258 282 7.37e-4 SMART
ZnF_C2H2 288 310 5.06e-2 SMART
ZnF_C2H2 318 340 3.44e-4 SMART
low complexity region 346 404 N/A INTRINSIC
low complexity region 405 410 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084275
SMART Domains Protein: ENSMUSP00000081296
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088308
SMART Domains Protein: ENSMUSP00000085648
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112417
SMART Domains Protein: ENSMUSP00000108036
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 6.5e-35 PFAM
low complexity region 118 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112424
SMART Domains Protein: ENSMUSP00000108043
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 172 183 N/A INTRINSIC
ZnF_C2H2 213 235 7.26e-3 SMART
ZnF_C2H2 241 263 2.99e-4 SMART
ZnF_C2H2 269 291 1.95e-3 SMART
ZnF_C2H2 302 324 7.37e-4 SMART
ZnF_C2H2 330 352 2.95e-3 SMART
ZnF_C2H2 358 382 7.37e-4 SMART
ZnF_C2H2 388 410 5.06e-2 SMART
ZnF_C2H2 418 440 3.44e-4 SMART
low complexity region 446 504 N/A INTRINSIC
low complexity region 505 510 N/A INTRINSIC
low complexity region 513 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112425
SMART Domains Protein: ENSMUSP00000108044
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 313 337 7.37e-4 SMART
ZnF_C2H2 343 365 5.06e-2 SMART
ZnF_C2H2 373 395 3.44e-4 SMART
low complexity region 401 459 N/A INTRINSIC
low complexity region 460 465 N/A INTRINSIC
low complexity region 468 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112427
SMART Domains Protein: ENSMUSP00000108046
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112428
SMART Domains Protein: ENSMUSP00000108047
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 260 282 3.47e0 SMART
ZnF_C2H2 288 310 2.99e-4 SMART
ZnF_C2H2 316 338 1.95e-3 SMART
ZnF_C2H2 344 368 7.37e-4 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 404 426 3.44e-4 SMART
low complexity region 432 490 N/A INTRINSIC
low complexity region 491 496 N/A INTRINSIC
low complexity region 499 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140131
SMART Domains Protein: ENSMUSP00000121519
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 6 107 2.1e-35 PFAM
low complexity region 114 139 N/A INTRINSIC
PHD 198 243 3.67e-12 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger protein, which may function as a transcription factor. This gene also contains long CAG trinucleotide repeats that encode consecutive glutamine residues. The protein appears to bind and regulate the promoters of the extracellular matrix genes MMP1, MMP3, MMP7 and COL1A1. Studies in mouse suggest that nuclear matrix transcription factors (NP/NMP4) may be part of a general mechanical pathway that couples cell construction and function during extracellular matrix remodeling. Alternative splicing results in multiple transcript variants. Recurrent rearrangements of this gene with the Ewing's sarcoma gene, EWSR1 on chromosome 22, or with the TAF15 gene on chromosome 17, or with the TCF3 (E2A) gene on chromosome 19, have been observed in acute leukemia. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mice are small and males have a small testis. Some males develop infertility and exhibit variable degrees of spermatogenic cell degeneration within the seminiferous tubules and increased apoptosis of spermatogenic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
AI837181 GGC GGCTGC 19: 5,475,263 (GRCm39) probably benign Het
Angptl1 A T 1: 156,684,794 (GRCm39) Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 52,043,050 (GRCm39) probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,162,653 (GRCm39) probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,162,675 (GRCm39) probably benign Het
Car13 T C 3: 14,719,974 (GRCm39) Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,619,805 (GRCm39) probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,619,810 (GRCm39) probably benign Het
Cdh26 T C 2: 178,108,424 (GRCm39) C341R probably damaging Het
Chga GCA GCACCA 12: 102,527,680 (GRCm39) probably benign Het
Col11a1 A T 3: 114,010,650 (GRCm39) I1689L unknown Het
Dnah6 T G 6: 73,078,872 (GRCm39) S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,674,160 (GRCm39) probably benign Het
Fah A C 7: 84,238,836 (GRCm39) N336K probably damaging Het
Fbxo11 A T 17: 88,303,481 (GRCm39) I664K Het
Fcgbp A G 7: 27,789,180 (GRCm39) D582G probably benign Het
Gabre C CCGGCTA X: 71,313,663 (GRCm39) probably null Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm1110 A G 9: 26,831,936 (GRCm39) Y72H probably damaging Het
Inpp5e C T 2: 26,298,389 (GRCm39) A71T possibly damaging Het
Iqcm C T 8: 76,304,527 (GRCm39) T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 92,925,590 (GRCm39) probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 92,925,606 (GRCm39) probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 75,185,014 (GRCm39) probably benign Het
Lyst A G 13: 13,808,948 (GRCm39) D206G probably benign Het
Map4k5 A T 12: 69,903,630 (GRCm39) D58E probably damaging Het
Mapkapk2 A G 1: 130,984,250 (GRCm39) S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,702,545 (GRCm39) probably benign Het
Men1 T C 19: 6,390,146 (GRCm39) S600P probably damaging Het
Mllt1 C T 17: 57,203,300 (GRCm39) V394M probably benign Het
Mllt1 C A 17: 57,203,301 (GRCm39) M393I possibly damaging Het
Nacc1 T C 8: 85,402,848 (GRCm39) E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,891,047 (GRCm39) probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,050 (GRCm39) probably benign Het
Nid2 TAACACCGCCA TA 14: 19,801,434 (GRCm39) probably benign Het
Or5b122 T A 19: 13,563,415 (GRCm39) I206N probably damaging Het
Parp2 A G 14: 51,054,843 (GRCm39) E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,006,686 (GRCm39) probably null Het
Pop1 G A 15: 34,502,583 (GRCm39) G90D probably damaging Het
Ppp3cc T C 14: 70,504,788 (GRCm39) T73A possibly damaging Het
Prdm15 C T 16: 97,600,829 (GRCm39) D810N probably damaging Het
Prpf4b T A 13: 35,068,219 (GRCm39) S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,756,780 (GRCm39) probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,756,784 (GRCm39) probably null Het
Sdk2 T C 11: 113,776,078 (GRCm39) E208G probably benign Het
Smurf2 G T 11: 106,743,413 (GRCm39) P211Q probably benign Het
Snx25 C A 8: 46,569,218 (GRCm39) probably null Het
Spata6 T A 4: 111,685,502 (GRCm39) M469K probably benign Het
Spta1 G T 1: 174,058,926 (GRCm39) A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 (GRCm39) probably benign Het
Stard8 GAG GAGTAG X: 98,110,121 (GRCm39) probably null Het
Tfeb AGC AGCGGC 17: 48,097,027 (GRCm39) probably benign Het
Tlcd1 T A 11: 78,071,020 (GRCm39) L203Q probably benign Het
Tlr11 T C 14: 50,598,682 (GRCm39) F223L possibly damaging Het
Usp48 T A 4: 137,333,106 (GRCm39) V100D probably damaging Het
Vinac1 A G 2: 128,880,714 (GRCm39) F404S Het
Vmn2r56 G A 7: 12,428,757 (GRCm39) T503I probably benign Het
Vps18 T C 2: 119,127,871 (GRCm39) L898P probably damaging Het
Zfp706 T A 15: 37,003,949 (GRCm39) Y39F probably benign Het
Zhx3 T A 2: 160,623,726 (GRCm39) N147I probably damaging Het
Other mutations in Zfp384
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Zfp384 APN 6 125,002,016 (GRCm39) missense probably benign 0.03
IGL01568:Zfp384 APN 6 125,001,095 (GRCm39) missense probably damaging 1.00
IGL01632:Zfp384 APN 6 125,001,724 (GRCm39) missense probably damaging 1.00
IGL03408:Zfp384 APN 6 125,012,676 (GRCm39) missense probably damaging 1.00
FR4304:Zfp384 UTSW 6 125,013,456 (GRCm39) unclassified probably benign
FR4340:Zfp384 UTSW 6 125,013,426 (GRCm39) unclassified probably benign
R0839:Zfp384 UTSW 6 125,013,631 (GRCm39) missense probably benign 0.01
R1370:Zfp384 UTSW 6 125,013,416 (GRCm39) missense probably benign 0.04
R1427:Zfp384 UTSW 6 125,001,847 (GRCm39) missense probably damaging 1.00
R2441:Zfp384 UTSW 6 125,013,612 (GRCm39) missense probably benign 0.01
R2986:Zfp384 UTSW 6 125,001,859 (GRCm39) missense possibly damaging 0.78
R4003:Zfp384 UTSW 6 125,010,200 (GRCm39) splice site probably benign
R4833:Zfp384 UTSW 6 125,007,811 (GRCm39) missense probably damaging 1.00
R4860:Zfp384 UTSW 6 125,007,893 (GRCm39) synonymous silent
R5084:Zfp384 UTSW 6 125,000,642 (GRCm39) splice site probably benign
R5137:Zfp384 UTSW 6 125,013,472 (GRCm39) unclassified probably benign
R5449:Zfp384 UTSW 6 125,001,101 (GRCm39) missense probably damaging 1.00
R5558:Zfp384 UTSW 6 125,013,472 (GRCm39) unclassified probably benign
R5720:Zfp384 UTSW 6 125,013,587 (GRCm39) missense probably benign 0.19
R5849:Zfp384 UTSW 6 125,001,062 (GRCm39) missense possibly damaging 0.91
R5961:Zfp384 UTSW 6 125,000,997 (GRCm39) missense probably damaging 1.00
R6165:Zfp384 UTSW 6 125,001,896 (GRCm39) splice site probably null
R6948:Zfp384 UTSW 6 125,001,873 (GRCm39) missense probably benign 0.08
R7106:Zfp384 UTSW 6 125,001,222 (GRCm39) missense probably benign 0.23
R7192:Zfp384 UTSW 6 125,010,275 (GRCm39) missense probably damaging 1.00
R7320:Zfp384 UTSW 6 125,001,793 (GRCm39) missense possibly damaging 0.92
R7730:Zfp384 UTSW 6 125,008,635 (GRCm39) missense probably benign 0.02
R7861:Zfp384 UTSW 6 125,013,288 (GRCm39) missense probably damaging 1.00
R8080:Zfp384 UTSW 6 125,013,521 (GRCm39) missense unknown
R9021:Zfp384 UTSW 6 125,013,336 (GRCm39) missense
R9568:Zfp384 UTSW 6 125,001,796 (GRCm39) missense possibly damaging 0.70
R9606:Zfp384 UTSW 6 125,007,802 (GRCm39) missense possibly damaging 0.85
RF003:Zfp384 UTSW 6 125,013,446 (GRCm39) unclassified probably benign
RF003:Zfp384 UTSW 6 125,013,439 (GRCm39) unclassified probably benign
RF003:Zfp384 UTSW 6 125,013,434 (GRCm39) unclassified probably benign
RF010:Zfp384 UTSW 6 125,013,451 (GRCm39) unclassified probably benign
RF010:Zfp384 UTSW 6 125,013,434 (GRCm39) unclassified probably benign
RF011:Zfp384 UTSW 6 125,013,439 (GRCm39) unclassified probably benign
RF014:Zfp384 UTSW 6 125,013,429 (GRCm39) unclassified probably benign
RF015:Zfp384 UTSW 6 125,013,444 (GRCm39) unclassified probably benign
RF018:Zfp384 UTSW 6 125,013,452 (GRCm39) unclassified probably benign
RF020:Zfp384 UTSW 6 125,013,451 (GRCm39) unclassified probably benign
RF020:Zfp384 UTSW 6 125,013,418 (GRCm39) unclassified probably benign
RF022:Zfp384 UTSW 6 125,013,434 (GRCm39) unclassified probably benign
RF024:Zfp384 UTSW 6 125,013,452 (GRCm39) unclassified probably benign
RF026:Zfp384 UTSW 6 125,013,455 (GRCm39) unclassified probably benign
RF027:Zfp384 UTSW 6 125,013,453 (GRCm39) unclassified probably benign
RF030:Zfp384 UTSW 6 125,013,446 (GRCm39) unclassified probably benign
RF056:Zfp384 UTSW 6 125,013,453 (GRCm39) unclassified probably benign
RF057:Zfp384 UTSW 6 125,013,459 (GRCm39) unclassified probably benign
RF062:Zfp384 UTSW 6 125,013,429 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGAGCCCAGGTTGAGACTTG -3'
(R):5'- ATGCTCTGCCGGCTTATAG -3'

Sequencing Primer
(F):5'- CCAGGTTGAGACTTGCAGGTTG -3'
(R):5'- CCGGCTTATAGGGGGTCAAGTC -3'
Posted On 2019-12-04