Incidental Mutation 'RF002:Fcgbp'
ID 602558
Institutional Source Beutler Lab
Gene Symbol Fcgbp
Ensembl Gene ENSMUSG00000047730
Gene Name Fc fragment of IgG binding protein
Synonyms A430096B05Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 27770661-27820287 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27789180 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 582 (D582G)
Ref Sequence ENSEMBL: ENSMUSP00000075945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076648] [ENSMUST00000138392]
AlphaFold E9Q0B5
Predicted Effect probably benign
Transcript: ENSMUST00000076648
AA Change: D582G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075945
Gene: ENSMUSG00000047730
AA Change: D582G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 1.2e-12 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 6.85e-35 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 4.7e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.7e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 5e-12 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138392
AA Change: D582G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114271
Gene: ENSMUSG00000047730
AA Change: D582G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 8.4e-13 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 7.99e-36 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 3.3e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.9e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 1e-11 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
AI837181 GGC GGCTGC 19: 5,475,263 (GRCm39) probably benign Het
Angptl1 A T 1: 156,684,794 (GRCm39) Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 52,043,050 (GRCm39) probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,162,653 (GRCm39) probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,162,675 (GRCm39) probably benign Het
Car13 T C 3: 14,719,974 (GRCm39) Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,619,805 (GRCm39) probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,619,810 (GRCm39) probably benign Het
Cdh26 T C 2: 178,108,424 (GRCm39) C341R probably damaging Het
Chga GCA GCACCA 12: 102,527,680 (GRCm39) probably benign Het
Col11a1 A T 3: 114,010,650 (GRCm39) I1689L unknown Het
Dnah6 T G 6: 73,078,872 (GRCm39) S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,674,160 (GRCm39) probably benign Het
Fah A C 7: 84,238,836 (GRCm39) N336K probably damaging Het
Fbxo11 A T 17: 88,303,481 (GRCm39) I664K Het
Gabre C CCGGCTA X: 71,313,663 (GRCm39) probably null Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm1110 A G 9: 26,831,936 (GRCm39) Y72H probably damaging Het
Inpp5e C T 2: 26,298,389 (GRCm39) A71T possibly damaging Het
Iqcm C T 8: 76,304,527 (GRCm39) T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 92,925,590 (GRCm39) probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 92,925,606 (GRCm39) probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 75,185,014 (GRCm39) probably benign Het
Lyst A G 13: 13,808,948 (GRCm39) D206G probably benign Het
Map4k5 A T 12: 69,903,630 (GRCm39) D58E probably damaging Het
Mapkapk2 A G 1: 130,984,250 (GRCm39) S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,702,545 (GRCm39) probably benign Het
Men1 T C 19: 6,390,146 (GRCm39) S600P probably damaging Het
Mllt1 C T 17: 57,203,300 (GRCm39) V394M probably benign Het
Mllt1 C A 17: 57,203,301 (GRCm39) M393I possibly damaging Het
Nacc1 T C 8: 85,402,848 (GRCm39) E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,891,047 (GRCm39) probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,050 (GRCm39) probably benign Het
Nid2 TAACACCGCCA TA 14: 19,801,434 (GRCm39) probably benign Het
Or5b122 T A 19: 13,563,415 (GRCm39) I206N probably damaging Het
Parp2 A G 14: 51,054,843 (GRCm39) E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,006,686 (GRCm39) probably null Het
Pop1 G A 15: 34,502,583 (GRCm39) G90D probably damaging Het
Ppp3cc T C 14: 70,504,788 (GRCm39) T73A possibly damaging Het
Prdm15 C T 16: 97,600,829 (GRCm39) D810N probably damaging Het
Prpf4b T A 13: 35,068,219 (GRCm39) S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,756,780 (GRCm39) probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,756,784 (GRCm39) probably null Het
Sdk2 T C 11: 113,776,078 (GRCm39) E208G probably benign Het
Smurf2 G T 11: 106,743,413 (GRCm39) P211Q probably benign Het
Snx25 C A 8: 46,569,218 (GRCm39) probably null Het
Spata6 T A 4: 111,685,502 (GRCm39) M469K probably benign Het
Spta1 G T 1: 174,058,926 (GRCm39) A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 (GRCm39) probably benign Het
Stard8 GAG GAGTAG X: 98,110,121 (GRCm39) probably null Het
Tfeb AGC AGCGGC 17: 48,097,027 (GRCm39) probably benign Het
Tlcd1 T A 11: 78,071,020 (GRCm39) L203Q probably benign Het
Tlr11 T C 14: 50,598,682 (GRCm39) F223L possibly damaging Het
Usp48 T A 4: 137,333,106 (GRCm39) V100D probably damaging Het
Vinac1 A G 2: 128,880,714 (GRCm39) F404S Het
Vmn2r56 G A 7: 12,428,757 (GRCm39) T503I probably benign Het
Vps18 T C 2: 119,127,871 (GRCm39) L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp706 T A 15: 37,003,949 (GRCm39) Y39F probably benign Het
Zhx3 T A 2: 160,623,726 (GRCm39) N147I probably damaging Het
Other mutations in Fcgbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Fcgbp APN 7 27,784,555 (GRCm39) missense probably damaging 1.00
IGL00331:Fcgbp APN 7 27,800,966 (GRCm39) splice site probably benign
IGL00335:Fcgbp APN 7 27,785,560 (GRCm39) missense possibly damaging 0.90
IGL00470:Fcgbp APN 7 27,774,511 (GRCm39) nonsense probably null
IGL00491:Fcgbp APN 7 27,792,827 (GRCm39) missense probably damaging 1.00
IGL00498:Fcgbp APN 7 27,791,222 (GRCm39) missense probably damaging 1.00
IGL01296:Fcgbp APN 7 27,789,072 (GRCm39) missense probably benign 0.15
IGL01582:Fcgbp APN 7 27,793,067 (GRCm39) missense probably benign 0.19
IGL01929:Fcgbp APN 7 27,803,388 (GRCm39) missense probably damaging 1.00
IGL02024:Fcgbp APN 7 27,805,799 (GRCm39) missense probably damaging 1.00
IGL02027:Fcgbp APN 7 27,774,629 (GRCm39) missense probably damaging 1.00
IGL02140:Fcgbp APN 7 27,791,379 (GRCm39) missense probably damaging 1.00
IGL02162:Fcgbp APN 7 27,774,660 (GRCm39) missense probably damaging 1.00
IGL02345:Fcgbp APN 7 27,771,068 (GRCm39) splice site probably benign
IGL02377:Fcgbp APN 7 27,806,395 (GRCm39) missense possibly damaging 0.67
IGL02389:Fcgbp APN 7 27,774,596 (GRCm39) missense probably damaging 1.00
IGL02423:Fcgbp APN 7 27,789,378 (GRCm39) missense probably benign 0.02
IGL02523:Fcgbp APN 7 27,804,157 (GRCm39) missense possibly damaging 0.89
IGL02561:Fcgbp APN 7 27,800,599 (GRCm39) intron probably benign
IGL02631:Fcgbp APN 7 27,784,723 (GRCm39) missense probably damaging 1.00
IGL02716:Fcgbp APN 7 27,800,859 (GRCm39) missense probably damaging 0.98
IGL02836:Fcgbp APN 7 27,816,783 (GRCm39) missense possibly damaging 0.91
IGL02957:Fcgbp APN 7 27,791,272 (GRCm39) nonsense probably null
IGL02971:Fcgbp APN 7 27,800,898 (GRCm39) missense probably damaging 1.00
IGL03284:Fcgbp APN 7 27,784,857 (GRCm39) missense possibly damaging 0.93
IGL03379:Fcgbp APN 7 27,789,342 (GRCm39) missense possibly damaging 0.76
bilge UTSW 7 27,816,762 (GRCm39) missense probably benign 0.00
R6548_fcgbp_365 UTSW 7 27,791,343 (GRCm39) missense probably benign 0.00
swill UTSW 7 27,789,159 (GRCm39) missense probably damaging 1.00
G1citation:Fcgbp UTSW 7 27,806,781 (GRCm39) missense probably damaging 1.00
IGL02796:Fcgbp UTSW 7 27,800,576 (GRCm39) intron probably benign
PIT4486001:Fcgbp UTSW 7 27,774,698 (GRCm39) missense possibly damaging 0.52
R0277:Fcgbp UTSW 7 27,784,918 (GRCm39) critical splice donor site probably null
R0387:Fcgbp UTSW 7 27,790,879 (GRCm39) splice site probably benign
R0586:Fcgbp UTSW 7 27,789,138 (GRCm39) missense probably damaging 1.00
R0981:Fcgbp UTSW 7 27,784,535 (GRCm39) nonsense probably null
R0987:Fcgbp UTSW 7 27,793,599 (GRCm39) missense probably damaging 1.00
R1240:Fcgbp UTSW 7 27,819,950 (GRCm39) missense probably damaging 1.00
R1394:Fcgbp UTSW 7 27,792,804 (GRCm39) missense probably damaging 0.98
R1395:Fcgbp UTSW 7 27,792,804 (GRCm39) missense probably damaging 0.98
R1438:Fcgbp UTSW 7 27,803,158 (GRCm39) nonsense probably null
R1474:Fcgbp UTSW 7 27,791,273 (GRCm39) missense probably benign 0.00
R1521:Fcgbp UTSW 7 27,774,585 (GRCm39) missense probably benign 0.00
R1740:Fcgbp UTSW 7 27,800,674 (GRCm39) missense possibly damaging 0.87
R1750:Fcgbp UTSW 7 27,792,868 (GRCm39) nonsense probably null
R1772:Fcgbp UTSW 7 27,804,600 (GRCm39) missense possibly damaging 0.90
R1804:Fcgbp UTSW 7 27,785,564 (GRCm39) missense probably benign
R1808:Fcgbp UTSW 7 27,784,515 (GRCm39) missense probably benign 0.04
R1819:Fcgbp UTSW 7 27,784,708 (GRCm39) missense probably benign 0.00
R1934:Fcgbp UTSW 7 27,806,518 (GRCm39) missense probably damaging 1.00
R1972:Fcgbp UTSW 7 27,793,617 (GRCm39) missense probably benign 0.11
R2051:Fcgbp UTSW 7 27,819,785 (GRCm39) missense probably damaging 0.97
R2072:Fcgbp UTSW 7 27,819,814 (GRCm39) missense probably damaging 0.98
R2074:Fcgbp UTSW 7 27,819,814 (GRCm39) missense probably damaging 0.98
R2124:Fcgbp UTSW 7 27,791,444 (GRCm39) missense probably benign 0.03
R2155:Fcgbp UTSW 7 27,806,628 (GRCm39) missense probably benign 0.00
R3015:Fcgbp UTSW 7 27,774,838 (GRCm39) splice site probably benign
R3037:Fcgbp UTSW 7 27,802,127 (GRCm39) missense possibly damaging 0.62
R3151:Fcgbp UTSW 7 27,816,665 (GRCm39) missense probably damaging 1.00
R3176:Fcgbp UTSW 7 27,791,086 (GRCm39) missense probably damaging 0.99
R3177:Fcgbp UTSW 7 27,791,086 (GRCm39) missense probably damaging 0.99
R3276:Fcgbp UTSW 7 27,791,086 (GRCm39) missense probably damaging 0.99
R3277:Fcgbp UTSW 7 27,791,086 (GRCm39) missense probably damaging 0.99
R3623:Fcgbp UTSW 7 27,800,701 (GRCm39) missense probably damaging 1.00
R3730:Fcgbp UTSW 7 27,784,882 (GRCm39) missense possibly damaging 0.82
R3935:Fcgbp UTSW 7 27,774,824 (GRCm39) missense probably benign 0.00
R3936:Fcgbp UTSW 7 27,774,824 (GRCm39) missense probably benign 0.00
R4041:Fcgbp UTSW 7 27,813,404 (GRCm39) missense probably benign 0.01
R4056:Fcgbp UTSW 7 27,803,541 (GRCm39) missense probably benign 0.09
R4057:Fcgbp UTSW 7 27,803,541 (GRCm39) missense probably benign 0.09
R4705:Fcgbp UTSW 7 27,806,721 (GRCm39) missense probably benign 0.44
R4708:Fcgbp UTSW 7 27,794,386 (GRCm39) missense probably benign 0.00
R4710:Fcgbp UTSW 7 27,794,386 (GRCm39) missense probably benign 0.00
R4779:Fcgbp UTSW 7 27,794,362 (GRCm39) missense probably damaging 1.00
R4820:Fcgbp UTSW 7 27,813,383 (GRCm39) missense probably damaging 1.00
R4863:Fcgbp UTSW 7 27,785,769 (GRCm39) missense probably benign 0.33
R4926:Fcgbp UTSW 7 27,785,660 (GRCm39) missense probably damaging 0.99
R4947:Fcgbp UTSW 7 27,789,237 (GRCm39) missense probably benign 0.00
R4979:Fcgbp UTSW 7 27,816,995 (GRCm39) missense probably benign 0.06
R5002:Fcgbp UTSW 7 27,785,528 (GRCm39) splice site probably null
R5219:Fcgbp UTSW 7 27,803,510 (GRCm39) missense probably damaging 1.00
R5241:Fcgbp UTSW 7 27,784,624 (GRCm39) missense probably damaging 1.00
R5301:Fcgbp UTSW 7 27,793,099 (GRCm39) missense possibly damaging 0.93
R5306:Fcgbp UTSW 7 27,791,243 (GRCm39) missense probably damaging 1.00
R5335:Fcgbp UTSW 7 27,789,159 (GRCm39) missense probably damaging 1.00
R5399:Fcgbp UTSW 7 27,804,480 (GRCm39) missense probably benign 0.05
R5418:Fcgbp UTSW 7 27,784,738 (GRCm39) missense probably damaging 1.00
R5527:Fcgbp UTSW 7 27,793,060 (GRCm39) missense probably benign
R5583:Fcgbp UTSW 7 27,791,004 (GRCm39) missense probably damaging 1.00
R5698:Fcgbp UTSW 7 27,791,447 (GRCm39) missense possibly damaging 0.95
R5780:Fcgbp UTSW 7 27,784,643 (GRCm39) missense probably benign 0.02
R5813:Fcgbp UTSW 7 27,800,919 (GRCm39) missense possibly damaging 0.64
R5910:Fcgbp UTSW 7 27,784,928 (GRCm39) splice site probably benign
R5936:Fcgbp UTSW 7 27,786,117 (GRCm39) missense probably damaging 0.98
R5992:Fcgbp UTSW 7 27,819,959 (GRCm39) missense probably benign 0.05
R6091:Fcgbp UTSW 7 27,804,390 (GRCm39) missense possibly damaging 0.90
R6372:Fcgbp UTSW 7 27,806,433 (GRCm39) missense probably damaging 1.00
R6488:Fcgbp UTSW 7 27,792,963 (GRCm39) missense probably damaging 0.96
R6548:Fcgbp UTSW 7 27,791,343 (GRCm39) missense probably benign 0.00
R6553:Fcgbp UTSW 7 27,813,404 (GRCm39) missense possibly damaging 0.79
R6585:Fcgbp UTSW 7 27,813,404 (GRCm39) missense possibly damaging 0.79
R6695:Fcgbp UTSW 7 27,785,695 (GRCm39) nonsense probably null
R6711:Fcgbp UTSW 7 27,789,098 (GRCm39) missense probably damaging 0.99
R6803:Fcgbp UTSW 7 27,802,637 (GRCm39) missense probably benign 0.00
R6822:Fcgbp UTSW 7 27,806,781 (GRCm39) missense probably damaging 1.00
R6907:Fcgbp UTSW 7 27,784,443 (GRCm39) missense probably damaging 1.00
R6912:Fcgbp UTSW 7 27,789,129 (GRCm39) missense probably benign 0.15
R6924:Fcgbp UTSW 7 27,793,248 (GRCm39) missense probably benign
R6943:Fcgbp UTSW 7 27,791,477 (GRCm39) missense probably benign 0.22
R7060:Fcgbp UTSW 7 27,791,358 (GRCm39) missense probably benign 0.20
R7103:Fcgbp UTSW 7 27,784,387 (GRCm39) missense probably benign 0.00
R7208:Fcgbp UTSW 7 27,803,446 (GRCm39) missense probably benign 0.01
R7291:Fcgbp UTSW 7 27,800,817 (GRCm39) missense probably benign 0.00
R7301:Fcgbp UTSW 7 27,792,861 (GRCm39) missense possibly damaging 0.65
R7404:Fcgbp UTSW 7 27,800,932 (GRCm39) missense probably damaging 1.00
R7426:Fcgbp UTSW 7 27,785,949 (GRCm39) missense probably benign 0.00
R7459:Fcgbp UTSW 7 27,806,710 (GRCm39) missense possibly damaging 0.65
R7475:Fcgbp UTSW 7 27,802,401 (GRCm39) missense probably damaging 0.99
R7505:Fcgbp UTSW 7 27,789,099 (GRCm39) missense probably damaging 0.97
R7517:Fcgbp UTSW 7 27,784,794 (GRCm39) missense probably damaging 1.00
R7519:Fcgbp UTSW 7 27,785,724 (GRCm39) missense probably damaging 1.00
R7524:Fcgbp UTSW 7 27,802,391 (GRCm39) missense probably damaging 1.00
R7649:Fcgbp UTSW 7 27,790,928 (GRCm39) missense possibly damaging 0.88
R7782:Fcgbp UTSW 7 27,784,460 (GRCm39) nonsense probably null
R7820:Fcgbp UTSW 7 27,819,784 (GRCm39) missense probably benign 0.01
R7831:Fcgbp UTSW 7 27,806,404 (GRCm39) missense probably damaging 0.98
R7835:Fcgbp UTSW 7 27,816,632 (GRCm39) missense possibly damaging 0.64
R7947:Fcgbp UTSW 7 27,803,595 (GRCm39) critical splice donor site probably null
R8086:Fcgbp UTSW 7 27,813,389 (GRCm39) missense probably damaging 1.00
R8137:Fcgbp UTSW 7 27,804,496 (GRCm39) missense probably damaging 1.00
R8154:Fcgbp UTSW 7 27,784,507 (GRCm39) missense probably benign 0.00
R8169:Fcgbp UTSW 7 27,784,919 (GRCm39) critical splice donor site probably null
R8176:Fcgbp UTSW 7 27,791,174 (GRCm39) missense possibly damaging 0.88
R8193:Fcgbp UTSW 7 27,804,276 (GRCm39) missense probably damaging 1.00
R8313:Fcgbp UTSW 7 27,785,769 (GRCm39) missense probably benign 0.00
R8350:Fcgbp UTSW 7 27,793,614 (GRCm39) missense probably benign 0.02
R8382:Fcgbp UTSW 7 27,816,762 (GRCm39) missense probably benign 0.00
R8393:Fcgbp UTSW 7 27,806,815 (GRCm39) missense probably benign 0.18
R8438:Fcgbp UTSW 7 27,789,231 (GRCm39) missense probably benign 0.25
R8489:Fcgbp UTSW 7 27,804,435 (GRCm39) missense possibly damaging 0.94
R8495:Fcgbp UTSW 7 27,785,978 (GRCm39) missense probably damaging 1.00
R8707:Fcgbp UTSW 7 27,819,920 (GRCm39) missense probably benign 0.01
R8736:Fcgbp UTSW 7 27,805,621 (GRCm39) missense probably benign 0.05
R8816:Fcgbp UTSW 7 27,784,412 (GRCm39) missense probably benign 0.09
R8905:Fcgbp UTSW 7 27,785,934 (GRCm39) missense probably damaging 1.00
R9031:Fcgbp UTSW 7 27,790,908 (GRCm39) missense possibly damaging 0.89
R9063:Fcgbp UTSW 7 27,791,277 (GRCm39) missense probably damaging 1.00
R9180:Fcgbp UTSW 7 27,803,198 (GRCm39) nonsense probably null
R9262:Fcgbp UTSW 7 27,819,952 (GRCm39) missense probably damaging 1.00
R9439:Fcgbp UTSW 7 27,803,436 (GRCm39) missense possibly damaging 0.60
R9526:Fcgbp UTSW 7 27,790,937 (GRCm39) missense probably damaging 1.00
R9603:Fcgbp UTSW 7 27,802,563 (GRCm39) missense probably damaging 1.00
R9635:Fcgbp UTSW 7 27,800,832 (GRCm39) missense probably benign 0.40
R9703:Fcgbp UTSW 7 27,806,400 (GRCm39) missense probably damaging 0.98
R9711:Fcgbp UTSW 7 27,793,000 (GRCm39) missense probably benign 0.00
R9733:Fcgbp UTSW 7 27,803,012 (GRCm39) missense probably damaging 1.00
X0028:Fcgbp UTSW 7 27,803,445 (GRCm39) missense possibly damaging 0.48
Z1186:Fcgbp UTSW 7 27,791,072 (GRCm39) missense probably benign
Z1186:Fcgbp UTSW 7 27,789,180 (GRCm39) missense probably benign
Z1186:Fcgbp UTSW 7 27,785,616 (GRCm39) missense probably benign
Z1186:Fcgbp UTSW 7 27,803,309 (GRCm39) missense probably benign 0.09
Z1186:Fcgbp UTSW 7 27,792,770 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCAGCTGAGTGAAAACAC -3'
(R):5'- TCACAAGGGAGTCCAATTGG -3'

Sequencing Primer
(F):5'- GAAAACCCTGACTGACCTGTTG -3'
(R):5'- TCCAATTGGGGACAGTCACC -3'
Posted On 2019-12-04