Incidental Mutation 'RF002:Fam71e1'
ID602559
Institutional Source Beutler Lab
Gene Symbol Fam71e1
Ensembl Gene ENSMUSG00000051113
Gene Namefamily with sequence similarity 71, member E1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #RF002 (G1)
Quality Score217.473
Status Not validated
Chromosome7
Chromosomal Location44496581-44501486 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) CCTGGGTCTGAGGGAGGA to CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA at 44500520 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107927] [ENSMUST00000118515] [ENSMUST00000118808] [ENSMUST00000138328] [ENSMUST00000165208] [ENSMUST00000205359] [ENSMUST00000205422] [ENSMUST00000206398]
Predicted Effect probably benign
Transcript: ENSMUST00000107927
SMART Domains Protein: ENSMUSP00000103560
Gene: ENSMUSG00000051113

DomainStartEndE-ValueType
low complexity region 70 85 N/A INTRINSIC
Pfam:DUF3699 91 160 5.6e-20 PFAM
coiled coil region 164 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118515
SMART Domains Protein: ENSMUSP00000113141
Gene: ENSMUSG00000008140

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
low complexity region 239 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118808
SMART Domains Protein: ENSMUSP00000113509
Gene: ENSMUSG00000008140

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
transmembrane domain 221 243 N/A INTRINSIC
low complexity region 246 255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138328
SMART Domains Protein: ENSMUSP00000116293
Gene: ENSMUSG00000008140

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 154 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165208
SMART Domains Protein: ENSMUSP00000130127
Gene: ENSMUSG00000038670

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
IG 54 150 6.26e-5 SMART
PDB:2LHU|A 160 236 7e-9 PDB
low complexity region 237 252 N/A INTRINSIC
IG 258 337 5.21e-2 SMART
IG 347 430 1.2e-1 SMART
IG 440 526 2.72e-5 SMART
IG 546 631 1.68e-5 SMART
FN3 634 717 3.29e-11 SMART
FN3 732 815 1.23e-10 SMART
IG 842 925 6.07e-3 SMART
FN3 928 1010 2.08e-8 SMART
IGc2 1055 1122 6.91e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000205359
Predicted Effect probably benign
Transcript: ENSMUST00000205422
Predicted Effect probably benign
Transcript: ENSMUST00000206398
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,941,047 probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,050 probably benign Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,608,925 probably null Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 probably benign Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Fam71e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1355:Fam71e1 UTSW 7 44496691 missense possibly damaging 0.82
R5308:Fam71e1 UTSW 7 44500182 missense probably damaging 1.00
R5568:Fam71e1 UTSW 7 44501004 missense probably damaging 0.99
R6038:Fam71e1 UTSW 7 44500295 missense probably damaging 1.00
R6038:Fam71e1 UTSW 7 44500295 missense probably damaging 1.00
R8136:Fam71e1 UTSW 7 44500280 missense probably damaging 0.99
RF003:Fam71e1 UTSW 7 44500527 frame shift probably null
RF013:Fam71e1 UTSW 7 44500520 frame shift probably null
RF015:Fam71e1 UTSW 7 44500522 frame shift probably null
RF017:Fam71e1 UTSW 7 44500525 frame shift probably null
RF017:Fam71e1 UTSW 7 44500531 frame shift probably null
RF020:Fam71e1 UTSW 7 44500535 frame shift probably null
RF034:Fam71e1 UTSW 7 44500523 frame shift probably null
RF038:Fam71e1 UTSW 7 44500522 frame shift probably null
RF040:Fam71e1 UTSW 7 44500521 frame shift probably null
RF040:Fam71e1 UTSW 7 44500531 frame shift probably null
RF045:Fam71e1 UTSW 7 44500532 frame shift probably null
RF047:Fam71e1 UTSW 7 44500529 frame shift probably null
RF047:Fam71e1 UTSW 7 44500536 frame shift probably null
RF050:Fam71e1 UTSW 7 44500521 frame shift probably null
RF051:Fam71e1 UTSW 7 44500523 frame shift probably null
RF055:Fam71e1 UTSW 7 44500533 nonsense probably null
RF056:Fam71e1 UTSW 7 44500527 frame shift probably null
RF057:Fam71e1 UTSW 7 44500532 frame shift probably null
RF060:Fam71e1 UTSW 7 44500525 frame shift probably null
RF060:Fam71e1 UTSW 7 44500533 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCGCCTTCTACTTGCAACTG -3'
(R):5'- TGGGCTAACAATATCAGCCAC -3'

Sequencing Primer
(F):5'- TGCCCTTCACGCACGAG -3'
(R):5'- CACAGTCCCTAGTCTGCTGCAG -3'
Posted On2019-12-04