Incidental Mutation 'RF002:Garin5a'
ID 602559
Institutional Source Beutler Lab
Gene Symbol Garin5a
Ensembl Gene ENSMUSG00000051113
Gene Name golgi associated RAB2 interactor 5A
Synonyms 1700021P22Rik, Fam71e1, 0610007G24Rik, 1700021N13Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # RF002 (G1)
Quality Score 217.473
Status Not validated
Chromosome 7
Chromosomal Location 44146005-44150910 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) CCTGGGTCTGAGGGAGGA to CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA at 44149944 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107927] [ENSMUST00000118515] [ENSMUST00000118808] [ENSMUST00000138328] [ENSMUST00000165208] [ENSMUST00000205359] [ENSMUST00000205422] [ENSMUST00000206398]
AlphaFold A1L3C1
Predicted Effect probably benign
Transcript: ENSMUST00000107927
SMART Domains Protein: ENSMUSP00000103560
Gene: ENSMUSG00000051113

DomainStartEndE-ValueType
low complexity region 70 85 N/A INTRINSIC
Pfam:DUF3699 91 160 5.6e-20 PFAM
coiled coil region 164 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118515
SMART Domains Protein: ENSMUSP00000113141
Gene: ENSMUSG00000008140

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
low complexity region 239 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118808
SMART Domains Protein: ENSMUSP00000113509
Gene: ENSMUSG00000008140

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
transmembrane domain 221 243 N/A INTRINSIC
low complexity region 246 255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138328
SMART Domains Protein: ENSMUSP00000116293
Gene: ENSMUSG00000008140

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 154 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165208
SMART Domains Protein: ENSMUSP00000130127
Gene: ENSMUSG00000038670

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
IG 54 150 6.26e-5 SMART
PDB:2LHU|A 160 236 7e-9 PDB
low complexity region 237 252 N/A INTRINSIC
IG 258 337 5.21e-2 SMART
IG 347 430 1.2e-1 SMART
IG 440 526 2.72e-5 SMART
IG 546 631 1.68e-5 SMART
FN3 634 717 3.29e-11 SMART
FN3 732 815 1.23e-10 SMART
IG 842 925 6.07e-3 SMART
FN3 928 1010 2.08e-8 SMART
IGc2 1055 1122 6.91e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000205359
Predicted Effect probably benign
Transcript: ENSMUST00000205422
Predicted Effect probably benign
Transcript: ENSMUST00000206398
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
AI837181 GGC GGCTGC 19: 5,475,263 (GRCm39) probably benign Het
Angptl1 A T 1: 156,684,794 (GRCm39) Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 52,043,050 (GRCm39) probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,162,653 (GRCm39) probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,162,675 (GRCm39) probably benign Het
Car13 T C 3: 14,719,974 (GRCm39) Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,619,805 (GRCm39) probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,619,810 (GRCm39) probably benign Het
Cdh26 T C 2: 178,108,424 (GRCm39) C341R probably damaging Het
Chga GCA GCACCA 12: 102,527,680 (GRCm39) probably benign Het
Col11a1 A T 3: 114,010,650 (GRCm39) I1689L unknown Het
Dnah6 T G 6: 73,078,872 (GRCm39) S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,674,160 (GRCm39) probably benign Het
Fah A C 7: 84,238,836 (GRCm39) N336K probably damaging Het
Fbxo11 A T 17: 88,303,481 (GRCm39) I664K Het
Fcgbp A G 7: 27,789,180 (GRCm39) D582G probably benign Het
Gabre C CCGGCTA X: 71,313,663 (GRCm39) probably null Het
Gm1110 A G 9: 26,831,936 (GRCm39) Y72H probably damaging Het
Inpp5e C T 2: 26,298,389 (GRCm39) A71T possibly damaging Het
Iqcm C T 8: 76,304,527 (GRCm39) T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 92,925,590 (GRCm39) probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 92,925,606 (GRCm39) probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 75,185,014 (GRCm39) probably benign Het
Lyst A G 13: 13,808,948 (GRCm39) D206G probably benign Het
Map4k5 A T 12: 69,903,630 (GRCm39) D58E probably damaging Het
Mapkapk2 A G 1: 130,984,250 (GRCm39) S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,702,545 (GRCm39) probably benign Het
Men1 T C 19: 6,390,146 (GRCm39) S600P probably damaging Het
Mllt1 C T 17: 57,203,300 (GRCm39) V394M probably benign Het
Mllt1 C A 17: 57,203,301 (GRCm39) M393I possibly damaging Het
Nacc1 T C 8: 85,402,848 (GRCm39) E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,891,047 (GRCm39) probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,050 (GRCm39) probably benign Het
Nid2 TAACACCGCCA TA 14: 19,801,434 (GRCm39) probably benign Het
Or5b122 T A 19: 13,563,415 (GRCm39) I206N probably damaging Het
Parp2 A G 14: 51,054,843 (GRCm39) E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,006,686 (GRCm39) probably null Het
Pop1 G A 15: 34,502,583 (GRCm39) G90D probably damaging Het
Ppp3cc T C 14: 70,504,788 (GRCm39) T73A possibly damaging Het
Prdm15 C T 16: 97,600,829 (GRCm39) D810N probably damaging Het
Prpf4b T A 13: 35,068,219 (GRCm39) S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,756,780 (GRCm39) probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,756,784 (GRCm39) probably null Het
Sdk2 T C 11: 113,776,078 (GRCm39) E208G probably benign Het
Smurf2 G T 11: 106,743,413 (GRCm39) P211Q probably benign Het
Snx25 C A 8: 46,569,218 (GRCm39) probably null Het
Spata6 T A 4: 111,685,502 (GRCm39) M469K probably benign Het
Spta1 G T 1: 174,058,926 (GRCm39) A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 (GRCm39) probably benign Het
Stard8 GAG GAGTAG X: 98,110,121 (GRCm39) probably null Het
Tfeb AGC AGCGGC 17: 48,097,027 (GRCm39) probably benign Het
Tlcd1 T A 11: 78,071,020 (GRCm39) L203Q probably benign Het
Tlr11 T C 14: 50,598,682 (GRCm39) F223L possibly damaging Het
Usp48 T A 4: 137,333,106 (GRCm39) V100D probably damaging Het
Vinac1 A G 2: 128,880,714 (GRCm39) F404S Het
Vmn2r56 G A 7: 12,428,757 (GRCm39) T503I probably benign Het
Vps18 T C 2: 119,127,871 (GRCm39) L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp706 T A 15: 37,003,949 (GRCm39) Y39F probably benign Het
Zhx3 T A 2: 160,623,726 (GRCm39) N147I probably damaging Het
Other mutations in Garin5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1355:Garin5a UTSW 7 44,146,115 (GRCm39) missense possibly damaging 0.82
R5308:Garin5a UTSW 7 44,149,606 (GRCm39) missense probably damaging 1.00
R5568:Garin5a UTSW 7 44,150,428 (GRCm39) missense probably damaging 0.99
R6038:Garin5a UTSW 7 44,149,719 (GRCm39) missense probably damaging 1.00
R6038:Garin5a UTSW 7 44,149,719 (GRCm39) missense probably damaging 1.00
R8136:Garin5a UTSW 7 44,149,704 (GRCm39) missense probably damaging 0.99
R8994:Garin5a UTSW 7 44,146,342 (GRCm39) missense probably benign 0.09
R9716:Garin5a UTSW 7 44,150,405 (GRCm39) missense probably damaging 1.00
RF003:Garin5a UTSW 7 44,149,951 (GRCm39) frame shift probably null
RF013:Garin5a UTSW 7 44,149,944 (GRCm39) frame shift probably null
RF015:Garin5a UTSW 7 44,149,946 (GRCm39) frame shift probably null
RF017:Garin5a UTSW 7 44,149,955 (GRCm39) frame shift probably null
RF017:Garin5a UTSW 7 44,149,949 (GRCm39) frame shift probably null
RF020:Garin5a UTSW 7 44,149,959 (GRCm39) frame shift probably null
RF034:Garin5a UTSW 7 44,149,947 (GRCm39) frame shift probably null
RF038:Garin5a UTSW 7 44,149,946 (GRCm39) frame shift probably null
RF040:Garin5a UTSW 7 44,149,955 (GRCm39) frame shift probably null
RF040:Garin5a UTSW 7 44,149,945 (GRCm39) frame shift probably null
RF045:Garin5a UTSW 7 44,149,956 (GRCm39) frame shift probably null
RF047:Garin5a UTSW 7 44,149,960 (GRCm39) frame shift probably null
RF047:Garin5a UTSW 7 44,149,953 (GRCm39) frame shift probably null
RF050:Garin5a UTSW 7 44,149,945 (GRCm39) frame shift probably null
RF051:Garin5a UTSW 7 44,149,947 (GRCm39) frame shift probably null
RF055:Garin5a UTSW 7 44,149,957 (GRCm39) nonsense probably null
RF056:Garin5a UTSW 7 44,149,951 (GRCm39) frame shift probably null
RF057:Garin5a UTSW 7 44,149,956 (GRCm39) frame shift probably null
RF060:Garin5a UTSW 7 44,149,957 (GRCm39) nonsense probably null
RF060:Garin5a UTSW 7 44,149,949 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCGCCTTCTACTTGCAACTG -3'
(R):5'- TGGGCTAACAATATCAGCCAC -3'

Sequencing Primer
(F):5'- TGCCCTTCACGCACGAG -3'
(R):5'- CACAGTCCCTAGTCTGCTGCAG -3'
Posted On 2019-12-04