Incidental Mutation 'RF002:Blm'
ID 602560
Institutional Source Beutler Lab
Gene Symbol Blm
Ensembl Gene ENSMUSG00000030528
Gene Name Bloom syndrome, RecQ like helicase
Synonyms
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF002 (G1)
Quality Score 217.468
Status Not validated
Chromosome 7
Chromosomal Location 80104741-80184896 bp(-) (GRCm39)
Type of Mutation small insertion (4 aa in frame mutation)
DNA Base Change (assembly) CCTCCTCCTCCTCCTCCTCCTCCT to CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT at 80162653 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]
AlphaFold O88700
Predicted Effect probably benign
Transcript: ENSMUST00000081314
SMART Domains Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 219 231 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
Pfam:BDHCT 376 416 5.5e-27 PFAM
low complexity region 557 574 N/A INTRINSIC
DEXDc 672 873 1.59e-29 SMART
HELICc 910 992 1.29e-24 SMART
RQC 1084 1198 1.43e-15 SMART
HRDC 1217 1297 9.4e-20 SMART
low complexity region 1357 1371 N/A INTRINSIC
low complexity region 1378 1392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170315
SMART Domains Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528

DomainStartEndE-ValueType
Pfam:BLM_N 4 375 1.1e-161 PFAM
Pfam:BDHCT 380 419 6.4e-25 PFAM
Pfam:BDHCT_assoc 433 658 8.8e-108 PFAM
DEXDc 675 876 1.59e-29 SMART
HELICc 913 995 1.29e-24 SMART
Pfam:RecQ_Zn_bind 1006 1078 1.5e-19 PFAM
RQC 1087 1201 1.43e-15 SMART
HRDC 1220 1300 9.4e-20 SMART
low complexity region 1360 1374 N/A INTRINSIC
low complexity region 1381 1395 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
AI837181 GGC GGCTGC 19: 5,475,263 (GRCm39) probably benign Het
Angptl1 A T 1: 156,684,794 (GRCm39) Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 52,043,050 (GRCm39) probably null Het
Car13 T C 3: 14,719,974 (GRCm39) Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,619,805 (GRCm39) probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,619,810 (GRCm39) probably benign Het
Cdh26 T C 2: 178,108,424 (GRCm39) C341R probably damaging Het
Chga GCA GCACCA 12: 102,527,680 (GRCm39) probably benign Het
Col11a1 A T 3: 114,010,650 (GRCm39) I1689L unknown Het
Dnah6 T G 6: 73,078,872 (GRCm39) S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,674,160 (GRCm39) probably benign Het
Fah A C 7: 84,238,836 (GRCm39) N336K probably damaging Het
Fbxo11 A T 17: 88,303,481 (GRCm39) I664K Het
Fcgbp A G 7: 27,789,180 (GRCm39) D582G probably benign Het
Gabre C CCGGCTA X: 71,313,663 (GRCm39) probably null Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm1110 A G 9: 26,831,936 (GRCm39) Y72H probably damaging Het
Inpp5e C T 2: 26,298,389 (GRCm39) A71T possibly damaging Het
Iqcm C T 8: 76,304,527 (GRCm39) T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 92,925,590 (GRCm39) probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 92,925,606 (GRCm39) probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 75,185,014 (GRCm39) probably benign Het
Lyst A G 13: 13,808,948 (GRCm39) D206G probably benign Het
Map4k5 A T 12: 69,903,630 (GRCm39) D58E probably damaging Het
Mapkapk2 A G 1: 130,984,250 (GRCm39) S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,702,545 (GRCm39) probably benign Het
Men1 T C 19: 6,390,146 (GRCm39) S600P probably damaging Het
Mllt1 C T 17: 57,203,300 (GRCm39) V394M probably benign Het
Mllt1 C A 17: 57,203,301 (GRCm39) M393I possibly damaging Het
Nacc1 T C 8: 85,402,848 (GRCm39) E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,891,047 (GRCm39) probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,050 (GRCm39) probably benign Het
Nid2 TAACACCGCCA TA 14: 19,801,434 (GRCm39) probably benign Het
Or5b122 T A 19: 13,563,415 (GRCm39) I206N probably damaging Het
Parp2 A G 14: 51,054,843 (GRCm39) E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,006,686 (GRCm39) probably null Het
Pop1 G A 15: 34,502,583 (GRCm39) G90D probably damaging Het
Ppp3cc T C 14: 70,504,788 (GRCm39) T73A possibly damaging Het
Prdm15 C T 16: 97,600,829 (GRCm39) D810N probably damaging Het
Prpf4b T A 13: 35,068,219 (GRCm39) S349R unknown Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,756,784 (GRCm39) probably null Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,756,780 (GRCm39) probably benign Het
Sdk2 T C 11: 113,776,078 (GRCm39) E208G probably benign Het
Smurf2 G T 11: 106,743,413 (GRCm39) P211Q probably benign Het
Snx25 C A 8: 46,569,218 (GRCm39) probably null Het
Spata6 T A 4: 111,685,502 (GRCm39) M469K probably benign Het
Spta1 G T 1: 174,058,926 (GRCm39) A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 (GRCm39) probably benign Het
Stard8 GAG GAGTAG X: 98,110,121 (GRCm39) probably null Het
Tfeb AGC AGCGGC 17: 48,097,027 (GRCm39) probably benign Het
Tlcd1 T A 11: 78,071,020 (GRCm39) L203Q probably benign Het
Tlr11 T C 14: 50,598,682 (GRCm39) F223L possibly damaging Het
Usp48 T A 4: 137,333,106 (GRCm39) V100D probably damaging Het
Vinac1 A G 2: 128,880,714 (GRCm39) F404S Het
Vmn2r56 G A 7: 12,428,757 (GRCm39) T503I probably benign Het
Vps18 T C 2: 119,127,871 (GRCm39) L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp706 T A 15: 37,003,949 (GRCm39) Y39F probably benign Het
Zhx3 T A 2: 160,623,726 (GRCm39) N147I probably damaging Het
Other mutations in Blm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Blm APN 7 80,123,819 (GRCm39) missense probably damaging 1.00
IGL01658:Blm APN 7 80,113,689 (GRCm39) missense probably damaging 0.98
IGL02048:Blm APN 7 80,152,709 (GRCm39) splice site probably benign
IGL02060:Blm APN 7 80,164,328 (GRCm39) splice site probably benign
IGL02063:Blm APN 7 80,159,167 (GRCm39) nonsense probably null
IGL02102:Blm APN 7 80,119,504 (GRCm39) missense probably damaging 1.00
IGL02420:Blm APN 7 80,145,754 (GRCm39) missense probably damaging 1.00
IGL02452:Blm APN 7 80,153,125 (GRCm39) splice site probably null
IGL02566:Blm APN 7 80,123,944 (GRCm39) missense probably damaging 1.00
IGL03387:Blm APN 7 80,143,895 (GRCm39) missense probably damaging 1.00
FR4304:Blm UTSW 7 80,162,667 (GRCm39) small insertion probably benign
FR4304:Blm UTSW 7 80,113,521 (GRCm39) frame shift probably null
FR4340:Blm UTSW 7 80,162,658 (GRCm39) small insertion probably benign
FR4340:Blm UTSW 7 80,162,655 (GRCm39) small insertion probably benign
FR4340:Blm UTSW 7 80,113,515 (GRCm39) unclassified probably benign
FR4449:Blm UTSW 7 80,162,656 (GRCm39) small insertion probably benign
FR4548:Blm UTSW 7 80,113,517 (GRCm39) frame shift probably null
FR4589:Blm UTSW 7 80,113,518 (GRCm39) frame shift probably null
FR4737:Blm UTSW 7 80,113,522 (GRCm39) frame shift probably null
FR4737:Blm UTSW 7 80,113,519 (GRCm39) frame shift probably null
FR4976:Blm UTSW 7 80,162,655 (GRCm39) small insertion probably benign
FR4976:Blm UTSW 7 80,113,515 (GRCm39) unclassified probably benign
R0133:Blm UTSW 7 80,152,115 (GRCm39) missense possibly damaging 0.93
R0194:Blm UTSW 7 80,114,694 (GRCm39) unclassified probably benign
R0526:Blm UTSW 7 80,155,641 (GRCm39) nonsense probably null
R0673:Blm UTSW 7 80,149,499 (GRCm39) critical splice donor site probably null
R0972:Blm UTSW 7 80,163,118 (GRCm39) missense probably benign
R0980:Blm UTSW 7 80,149,706 (GRCm39) splice site probably null
R1120:Blm UTSW 7 80,131,214 (GRCm39) missense probably damaging 1.00
R1301:Blm UTSW 7 80,105,165 (GRCm39) nonsense probably null
R1769:Blm UTSW 7 80,163,118 (GRCm39) missense probably benign
R1866:Blm UTSW 7 80,143,862 (GRCm39) missense probably benign 0.08
R1874:Blm UTSW 7 80,147,166 (GRCm39) missense probably damaging 1.00
R1966:Blm UTSW 7 80,162,934 (GRCm39) missense possibly damaging 0.86
R1991:Blm UTSW 7 80,155,697 (GRCm39) splice site probably null
R2013:Blm UTSW 7 80,152,147 (GRCm39) missense probably damaging 0.99
R2014:Blm UTSW 7 80,152,147 (GRCm39) missense probably damaging 0.99
R2015:Blm UTSW 7 80,152,147 (GRCm39) missense probably damaging 0.99
R2016:Blm UTSW 7 80,155,674 (GRCm39) missense probably benign 0.26
R2103:Blm UTSW 7 80,155,697 (GRCm39) splice site probably null
R2161:Blm UTSW 7 80,131,118 (GRCm39) splice site probably null
R2215:Blm UTSW 7 80,149,595 (GRCm39) missense possibly damaging 0.69
R3689:Blm UTSW 7 80,162,827 (GRCm39) missense possibly damaging 0.56
R4049:Blm UTSW 7 80,152,610 (GRCm39) missense probably benign 0.04
R4155:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R4695:Blm UTSW 7 80,143,976 (GRCm39) missense probably damaging 1.00
R4774:Blm UTSW 7 80,113,596 (GRCm39) missense probably damaging 1.00
R4833:Blm UTSW 7 80,116,574 (GRCm39) missense probably benign
R4835:Blm UTSW 7 80,159,294 (GRCm39) missense probably benign 0.41
R4994:Blm UTSW 7 80,108,573 (GRCm39) missense probably benign 0.00
R5039:Blm UTSW 7 80,155,621 (GRCm39) missense possibly damaging 0.50
R5330:Blm UTSW 7 80,108,684 (GRCm39) missense possibly damaging 0.73
R5375:Blm UTSW 7 80,162,977 (GRCm39) missense probably benign 0.00
R5408:Blm UTSW 7 80,152,370 (GRCm39) missense probably benign 0.01
R5574:Blm UTSW 7 80,149,521 (GRCm39) missense probably damaging 1.00
R5606:Blm UTSW 7 80,110,580 (GRCm39) splice site probably null
R5702:Blm UTSW 7 80,108,675 (GRCm39) missense probably benign 0.13
R5809:Blm UTSW 7 80,114,592 (GRCm39) missense probably damaging 1.00
R6114:Blm UTSW 7 80,163,235 (GRCm39) missense probably damaging 1.00
R6157:Blm UTSW 7 80,162,733 (GRCm39) missense probably benign 0.18
R6163:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R6254:Blm UTSW 7 80,130,090 (GRCm39) missense probably benign 0.04
R6266:Blm UTSW 7 80,149,688 (GRCm39) missense probably benign 0.03
R6364:Blm UTSW 7 80,144,274 (GRCm39) nonsense probably null
R6446:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R6502:Blm UTSW 7 80,131,223 (GRCm39) missense probably damaging 0.98
R6700:Blm UTSW 7 80,113,598 (GRCm39) missense possibly damaging 0.91
R7002:Blm UTSW 7 80,119,501 (GRCm39) missense probably benign 0.00
R7105:Blm UTSW 7 80,149,516 (GRCm39) missense probably benign 0.44
R7320:Blm UTSW 7 80,105,102 (GRCm39) nonsense probably null
R7465:Blm UTSW 7 80,162,863 (GRCm39) missense probably benign 0.02
R7561:Blm UTSW 7 80,152,276 (GRCm39) missense probably damaging 0.99
R8500:Blm UTSW 7 80,105,032 (GRCm39) missense probably damaging 1.00
R8543:Blm UTSW 7 80,143,964 (GRCm39) missense probably damaging 0.98
R8774-TAIL:Blm UTSW 7 80,162,667 (GRCm39) small insertion probably benign
R8774-TAIL:Blm UTSW 7 80,162,655 (GRCm39) small insertion probably benign
R8774-TAIL:Blm UTSW 7 80,162,666 (GRCm39) small insertion probably benign
R8775-TAIL:Blm UTSW 7 80,162,679 (GRCm39) small insertion probably benign
R8860:Blm UTSW 7 80,144,276 (GRCm39) missense probably benign 0.30
R8928:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R9089:Blm UTSW 7 80,162,867 (GRCm39) missense probably damaging 1.00
R9363:Blm UTSW 7 80,108,663 (GRCm39) missense probably damaging 1.00
RF001:Blm UTSW 7 80,162,675 (GRCm39) small insertion probably benign
RF001:Blm UTSW 7 80,162,651 (GRCm39) small insertion probably benign
RF001:Blm UTSW 7 80,162,654 (GRCm39) small insertion probably benign
RF002:Blm UTSW 7 80,162,675 (GRCm39) small insertion probably benign
RF007:Blm UTSW 7 80,162,681 (GRCm39) nonsense probably null
RF016:Blm UTSW 7 80,162,674 (GRCm39) nonsense probably null
RF018:Blm UTSW 7 80,162,674 (GRCm39) nonsense probably null
RF027:Blm UTSW 7 80,162,662 (GRCm39) frame shift probably null
RF028:Blm UTSW 7 80,162,653 (GRCm39) nonsense probably null
RF031:Blm UTSW 7 80,162,671 (GRCm39) small insertion probably benign
RF031:Blm UTSW 7 80,162,654 (GRCm39) small insertion probably benign
RF032:Blm UTSW 7 80,162,678 (GRCm39) small insertion probably benign
RF036:Blm UTSW 7 80,162,662 (GRCm39) nonsense probably null
RF044:Blm UTSW 7 80,162,678 (GRCm39) small insertion probably benign
RF053:Blm UTSW 7 80,162,669 (GRCm39) small insertion probably benign
RF064:Blm UTSW 7 80,162,671 (GRCm39) nonsense probably null
X0061:Blm UTSW 7 80,108,598 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACAACTGTCCTGTGTACCG -3'
(R):5'- ATGCGTTTGCTTCACTGGC -3'

Sequencing Primer
(F):5'- CCCAGTGCTCAGCTTTAGATTAG -3'
(R):5'- GCTTCACTGGCTAAAAATCCTG -3'
Posted On 2019-12-04